Clone Read LE_HBa0116A07_T7_249341

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0116A07_T7_249341
Primer
T7
ID from Seq. Facility
LE_HBa_116_A07-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
430 trimmed for vector and quality, 992 raw
Sequence
>LE_HBa0116A07_T7_249341 (raw untrimmed)
NATCACGTCGGGGATCTCTGAGTCGACCTGCAGGCATGCAAGCTTGCATTGCTGCTAGAACAGAAAGTACAGATCATTTTTGTTCCTCCAAAAGTAGTAA
CTCCCTCAGTTTC
GATTTGTTTGTTTTACTTTTGTTTATAGTTTGTTTCAAAAAGAACGTCTCTGTTTTTAAATTCTTTTGGCAATTCTATACTTCTAAC
TTTCACCTAACATATTTAAGTATAGATTTTGGAGGATTCGATGTACAAGCATTTTTGTAGAGACTGAGCAACTTAGGTCTGCCCGTAAGAAGGCATCAAG
ACAGAATTTTCATGGGATAACATAGTGAATTTCAATATGACTAAAATAATTACACCTTACTATTAAGAGTGATCAAATGATTACCTGCTTCACGAAGAGA
GCAGCAGTTATCGCACCACCTGGACGACCTCCCGTGTTCACCATATCAGCCACTCCTGATTTCATAGAGTCCCAGTAGCTATCCTCCATCGGCAACCTCC
ATAGTTTTTCACCGCTTACCTCAGAAGCTGCAACCACCTCCTTAGCTAGGTCATCGCTAGGTGTAAAAATACCTGTACAAGAGATCCAATAAAGTTCCAG
TACATTAGAAATTTATAGTTTATATATCAGTCACAGATTCACCGTAGCATCTTTCGTCCTCCAAAACCTGCAATTGGTGTCCCAATTATTTTTGTGCCCT
CAAAGTAACATTTGGTATTAAATTAGAACATTTAATAATAACCTGGATCTTCAAACAACAAACTTACCCATTGTAATCCCTTCAAGGGGGGCTGGGAAAG
GGTTAGGAAGTCCTCAGCACCCTTACCCCTCTCCCTTGTGTAAAATCAATAGGTTTTTTTCCAAATAGACCCCTGCTTAAACTTTCCACCAATTTTTTAA
CCACTCCTTTTTTACCCCAAAAATGGAAAGGTAATATAATTCGGCCCCCTTCCGATAATTACCCTGCCATTTGTGAGCGCCCATAATCTCTA
>LE_HBa0116A07_T7_249341 (trimmed for quality and cloning vector)
GATTTGTTTGTTTTACTTTTGTTTATAGTTTGTTTCAAAAAGAACGTCTCTGTTTTTAAATTCTTTTGGCAATTCTATACTTCTAACTTTCACCTAACAT
ATTTAAGTATAGATTTTGGAGGATTCGATGTACAAGCATTTTTGTAGAGACTGAGCAACTTAGGTCTGCCCGTAAGAAGGCATCAAGACAGAATTTTCAT
GGGATAACATAGTGAATTTCAATATGACTAAAATAATTACACCTTACTATTAAGAGTGATCAAATGATTACCTGCTTCACGAAGAGAGCAGCAGTTATCG
CACCACCTGGACGACCTCCCGTGTTCACCATATCAGCCACTCCTGATTTCATAGAGTCCCAGTAGCTATCCTCCATCGGCAACCTCCATAGTTTTTCACC
GCTTACCTCAGAAGCTGCAACCACCTCCTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.962467
Expected error %
1.83485
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g30920.1 Score 96 E Value 6e-21 Identity 26.70% Align. Length 164bp (38.14%) Frame 3
68417.m04390 cytosol aminopeptidase family protein contains Pfam profiles: PF00883 cytosol aminopeptidase family catalytic domain, PF02789: cytosol aminopeptidase family N-terminal domain
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g24200.1 Score 95 E Value 1e-20 Identity 26.10% Align. Length 164bp (38.14%) Frame 3
68415.m02891 cytosol aminopeptidase identical to cytosol aminopeptidase SP:P30184 from [Arabidopsis thaliana]; contains Pfam profiles: PF00883 cytosol aminopeptidase family catalytic domain, PF02789: cytosol aminopeptidase family N-terminal domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAO15916.1| Score 109 E Value 3e-23 Identity 31.50% Align. Length 164bp (38.14%) Frame 3
neutral leucine aminopeptidase preprotein; preLAP-N; metallo-exopeptidase; leucyl aminopeptidase; LAP [Lycopersicon esculentum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
sp|Q42876|AMPL2_LYCES Score 109 E Value 3e-23 Identity 31.50% Align. Length 164bp (38.14%) Frame 3
Aminopeptidase 2, chloroplast precursor (Leucine aminopeptidase) (LAP) (Leucyl aminopeptidase) (Proline aminopeptidase) (Prolyl aminopeptidase) gb|AAA80499.1| leucine aminopeptidase
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0116A07
Clone
Clone name
hba-116a7
LE_HBa0116A07
C12HBa0116A07
P116A07
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found