Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Clone Read LE_HBa0089A23_T7_25005

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0089A23_T7_25005
Primer
T7
ID from Seq. Facility
LE_HBa_089_A23-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
759 trimmed for vector and quality, 853 raw
Genbank Accession
Sequence
>LE_HBa0089A23_T7_25005 (raw untrimmed)
TCTAACTGGGGTCCGGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCACTATCCTCGTTCTACACTCTATAGAGGCAAAACAAGCATGCAAC
CAATCCATACTTAATATGACATCAAAATCAAACATATTAAGTTCTACTAGATCAACATAAGTAACTCTATTGGGAAACATTATAGGACAATTTATATATA
CTCTTTTTGCAACAACTGACTCACCCACCGGGGTTGACACAATAAAAGGTTTGTGCAATATATCGGGTGACATGTCAAACTTTTTAGCTACTAGAGGGGT
AAAAATGATAAAGTAGCACCTGGATCAAGTATGTTATATAGATCAATAGATAAGACTTTCAACATGCCGGTCACCACATCAGGAGAAGTGTCTTGCTCAC
CCCTAGATCACAGAGCATAGAAACGGTTCCTCTTCGAAGTTTTATTTGAACCACTTGCTTGTGCTTGACCAACAACCTTGTCTTGACCCCTCACATTAGG
GAAATCCCTAACCTTGTTCCCACTTTTACCACAACCAAAAAAATTATCCGTTCCTTTAAGACAATCACCATAGTGCTTCTTGCCACACTTTCCATAAGTT
GGCTTTTCGGTTATTGAACTAGTACCCTTTCTCTTTTAGGCTTAGGATTAGACACCCTATCATCCCTAGACTTAGGGAACTTAGAAGGAACTTGATTAGA
AACCCTTTTATTGAACCTAGGCTTGTATAGAATCTCAGGCCTTTCCTTTGAAGAACCACCATCAAAAGATCTTGCCCTCCTGGCATCTTTACTCTTCCTC
TTTGCCCTCGCTTCTTCCCTTGGTGGGGATTGAACACTGAGACGAAAAAAGTT
>LE_HBa0089A23_T7_25005 (trimmed for quality and cloning vector)
AGCTTCACTATCCTCGTTCTACACTCTATAGAGGCAAAACAAGCATGCAACCAATCCATACTTAATATGACATCAAAATCAAACATATTAAGTTCTACTA
GATCAACATAAGTAACTCTATTGGGAAACATTATAGGACAATTTATATATACTCTTTTTGCAACAACTGACTCACCCACCGGGGTTGACACAATAAAAGG
TTTGTGCAATATATCGGGTGACATGTCAAACTTTTTAGCTACTAGAGGGGTAAAAATGATAAAGTAGCACCTGGATCAAGTATGTTATATAGATCAATAG
ATAAGACTTTCAACATGCCGGTCACCACATCAGGAGAAGTGTCTTGCTCACCCCTAGATCACAGAGCATAGAAACGGTTCCTCTTCGAAGTTTTATTTGA
ACCACTTGCTTGTGCTTGACCAACAACCTTGTCTTGACCCCTCACATTAGGGAAATCCCTAACCTTGTTCCCACTTTTACCACAACCAAAAAAATTATCC
GTTCCTTTAAGACAATCACCATAGTGCTTCTTGCCACACTTTCCATAAGTTGGCTTTTCGGTTATTGAACTAGTACCCTTTCTCTTTTAGGCTTAGGATT
AGACACCCTATCATCCCTAGACTTAGGGAACTTAGAAGGAACTTGATTAGAAACCCTTTTATTGAACCTAGGCTTGTATAGAATCTCAGGCCTTTCCTTT
GAAGAACCACCATCAAAAGATCTTGCCCTCCTGGCATCTTTACTCTTCCTCTTTGCCCT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.963097
Expected error %
0.963141
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38744.1| Score 119 E Value 7e-41 Identity 41.20% Align. Length 550bp (72.46%) Frame 1
putative gag-pol polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38724.1| Score 119 E Value 7e-41 Identity 41.20% Align. Length 550bp (72.46%) Frame 1
putative retrotransposon protein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0089A23
Clone
Clone name
hba-89a23
LE_HBa0089A23
C08HBa0089A23
P089A23
Clone type
BAC
Contamination
none
Estimated length
117,569
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found