Clone Read LE_HBa0089B17_T7_25041

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0089B17_T7_25041
Primer
T7
ID from Seq. Facility
LE_HBa_089_B17-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
724 trimmed for vector and quality, 920 raw
Genbank Accession
Sequence
>LE_HBa0089B17_T7_25041 (raw untrimmed)
TGACCCGGGCCCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTGCACCGCTAATTTTTTTTCCTTTTAAGAGAATGAGATGAATATAGAA
AGAGCAGTAGGATGCCTTCAAAGCAGAGTCACCCCTGAATTGAAATGGAAAAAGCACTTTGTTGGTATTATAAGAAACCTTGAAAGCATAATTTGTTTGG
CATTTCGTTCATCATTCAATTTTCAGAAAAATAATGGTTTCTTTCTATGGATTTGTTGCCAGCAAAATTTGAAGTGTTTGACAATCATGTCCTCAGATAC
ATTCATCTTCTTTACTGAAAAGAAAAGCTCAATATTTAACACCATATTTATAAAACATATTTTTATCTTATTTGTGTAGAGATGAAATTATAAGATTAAA
GATATGTGAAATTTGAGAATAAAATTCCAAATTTCAAGAGAAGTGCTAATAACTCTATATAATTTTAGTATTCAAAACTAACATATCAATTCAAGAAGGT
AGATCTCTCATAACGCGTAATATATTCAAAATTTTAAAATTCAAACTAGTTCAAGTAAATGGTCCATAATCCTTTTAACTTTGCTGCAGAAGTTCGTAAT
TTAGAAGAATATTCATCATGAAACTCTCAACGACATTTTGGAGTCTGGATGTCTGAAAATTACAAACGATACAGAAGCGATGAAATCATTGTTGGAGATA
ATATTTTTTTTTTTACGAAAATGAAATCAGCATTTACAAGCTGAATTATAAATTGATGTATTGGGAAAAAAAAAACTTCAGGTATATACAAGCATAAAAC
TATCTCCAAATACTTTAGAACTTTAAAAAGTTCAAATCCATAACAAATAACTAAAATCAAAATTGGGTAACTTTTTTCCAAATAATAACAATGGGTGGAT
GCACTAGGGACTAAAAAATA
>LE_HBa0089B17_T7_25041 (trimmed for quality and cloning vector)
AGCTTTTGCACCGCTAATTTTTTTTCCTTTTAAGAGAATGAGATGAATATAGAAAGAGCAGTAGGATGCCTTCAAAGCAGAGTCACCCCTGAATTGAAAT
GGAAAAAGCACTTTGTTGGTATTATAAGAAACCTTGAAAGCATAATTTGTTTGGCATTTCGTTCATCATTCAATTTTCAGAAAAATAATGGTTTCTTTCT
ATGGATTTGTTGCCAGCAAAATTTGAAGTGTTTGACAATCATGTCCTCAGATACATTCATCTTCTTTACTGAAAAGAAAAGCTCAATATTTAACACCATA
TTTATAAAACATATTTTTATCTTATTTGTGTAGAGATGAAATTATAAGATTAAAGATATGTGAAATTTGAGAATAAAATTCCAAATTTCAAGAGAAGTGC
TAATAACTCTATATAATTTTAGTATTCAAAACTAACATATCAATTCAAGAAGGTAGATCTCTCATAACGCGTAATATATTCAAAATTTTAAAATTCAAAC
TAGTTCAAGTAAATGGTCCATAATCCTTTTAACTTTGCTGCAGAAGTTCGTAATTTAGAAGAATATTCATCATGAAACTCTCAACGACATTTTGGAGTCT
GGATGTCTGAAAATTACAAACGATACAGAAGCGATGAAATCATTGTTGGAGATAATATTTTTTTTTTTACGAAAATGAAATCAGCATTTACAAGCTGAAT
TATAAATTGATGTATTGGGAAAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.924424
Expected error %
0.773954
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0089B17
Clone
Clone name
hba-89b17
LE_HBa0089B17
C08HBa0089B17
P089B17
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found