Clone Read LE_HBa0089E18_SP6_25186

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0089E18_SP6_25186
Primer
SP6
ID from Seq. Facility
LE_HBa_089_E18-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
773 trimmed for vector and quality, 928 raw
Genbank Accession
Sequence
>LE_HBa0089E18_SP6_25186 (raw untrimmed)
CGGGCATTCCACTTGGGTCTTCAGAATTCTTTCTCAACTGCATGTTTTCACAAGTCCAATTGAAACCCGGCTTTTTCCACTGTTTATCTTCCTATAACCT
CCAGGTTCAAAGCTGGCTATGCCTGTGCTTCCTTGATCTGAATTTCTTGACTTGTCGAGAAAGATCTCTCTCCAAACATTTTTTTCTTCAGCCAGATGGC
AATATATGCTCTGAAAATTAAGCTGACAGAATTCCAGCCGATAAAAAGTATTGAAAACTGGATGGGCTGGAAACAGTGGTGTTGCACTAGAATCTGTTAC
AAGCGCCGCACATGATTGAGACTCAAGGAAATTACTTTTCCTCTCAATATGTGTCACTGCATGGCTGTTCCGTCTGGGAAGCCACTTCTGTGATTTGGTT
GCCTGGAACTTCCGACACCTTGGCTGTGGCCGGATCTACTAACTAGTCGCCAGTTTTGTCTCCAATGTCTTGGGCTTTTGACTGTCAGGGTGAACTGCCA
TTCTCTCTCTTACTGATATGGCAGTTAAAACTATATCAGATCATTGTCTTACTATTTATAAGAACAAAGATATTTAATGATAAACTTGAAAAATACATAC
TGGAAGATGGGGTGTCTGTTGCTTACAAACATTGGAATAAGAAAAAAAATGAAGACAACCTTCAGTAATAGACAATGAAATCTGTACCCGTGAACATTGT
CAGATAGTATACCATTCTGTCTAGTTCCTGAAATACCTGAACTCGTGCGTCATCCATAATTGTTTTTAAAAACAAAAAACAGAAAAAAGCAACAAAGTGA
AGCACACATTTTATGGGGAAAAAAAAATCATCTACGGTTAAATACATAAAAAATTTAAATTGTATTAAAATAACTAGTCAGCTTCAATATCCAATGCAAT
ATTAATCCAATTTTCAGGGTTAAACCCA
>LE_HBa0089E18_SP6_25186 (trimmed for quality and cloning vector)
GGTCTTCAGAATTCTTTCTCAACTGCATGTTTTCACAAGTCCAATTGAAACCCGGCTTTTTCCACTGTTTATCTTCCTATAACCTCCAGGTTCAAAGCTG
GCTATGCCTGTGCTTCCTTGATCTGAATTTCTTGACTTGTCGAGAAAGATCTCTCTCCAAACATTTTTTTCTTCAGCCAGATGGCAATATATGCTCTGAA
AATTAAGCTGACAGAATTCCAGCCGATAAAAAGTATTGAAAACTGGATGGGCTGGAAACAGTGGTGTTGCACTAGAATCTGTTACAAGCGCCGCACATGA
TTGAGACTCAAGGAAATTACTTTTCCTCTCAATATGTGTCACTGCATGGCTGTTCCGTCTGGGAAGCCACTTCTGTGATTTGGTTGCCTGGAACTTCCGA
CACCTTGGCTGTGGCCGGATCTACTAACTAGTCGCCAGTTTTGTCTCCAATGTCTTGGGCTTTTGACTGTCAGGGTGAACTGCCATTCTCTCTCTTACTG
ATATGGCAGTTAAAACTATATCAGATCATTGTCTTACTATTTATAAGAACAAAGATATTTAATGATAAACTTGAAAAATACATACTGGAAGATGGGGTGT
CTGTTGCTTACAAACATTGGAATAAGAAAAAAAATGAAGACAACCTTCAGTAATAGACAATGAAATCTGTACCCGTGAACATTGTCAGATAGTATACCAT
TCTGTCTAGTTCCTGAAATACCTGAACTCGTGCGTCATCCATAATTGTTTTTAAAAACAAAAAACAGAAAAAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.968427
Expected error %
0.312114
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0089E18
Clone
Clone name
hba-89e18
LE_HBa0089E18
C03HBa0089E18
P089E18
Clone type
BAC
Contamination
none
Estimated length
113,254
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found