Clone Read LE_HBa0089E18_T7_25187

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0089E18_T7_25187
Primer
T7
ID from Seq. Facility
LE_HBa_089_E18-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
842 trimmed for vector and quality, 939 raw
Genbank Accession
Sequence
>LE_HBa0089E18_T7_25187 (raw untrimmed)
ATTAAACTGGGTCCCGCGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTATTAAGAAGACAAACATGCAAATATTAATCTAAAAATTCAATTCT
ATATTGAGTTTTGAAATGCATATCAATGACAAATAGTTTAAGTGATTTAACATTATCATATAGTGGTTACATGTTACTATTTATTCTTAAATATTTTTTC
CTTAAAATATTTTATAGGAGTTATTGCTTAGTATTTAATAAGATAACATTAATAAATTAAACACTTTGAAAGTCTGAATTATTCTCCTAATTCATTATTT
AGCCATTATTATAATTAAAGTGAATGATGCATCAACCTGAAAAACATACTAATCTAAAAATAAAACTGTCGAGATATTGCTAAAAATTAAAATTAAAAAA
GGATCTATAATTTTAATTCATCTTAAAATTAGTAGTGGTAATTTCAATTTTTTATATAACCATATATTTTATAACATTCGATTTGATATAGAGACAAAAT
AGTAATCCAATAGAGAATTAAAGTAAGCCTTATGAGAAGTATTAAAATAGAAATTCAACTAATTATCAAATTAAAAATTTAAGAAGCAGAAAATTAAATA
ACATGCAGAGAAAAAAATTACAACTAACTTATTGTTTAATTAATATTAACAGGAAGAAAAAGGAATTACAGCTAATACTTATTATTTAATTAATATAATA
TTTAACTATAGTATATGGACAACGACAAAATAATAATCCATCTTTGAGATTTTGATCTTTCCATTTTTTAATGTAGGAATTATTTTACATTGAAGAGCAA
AATGATTGTTCATTCAACTTCTCAACTTTGGCTATTTAATATTTAATTAATTAGATATTTTATAATATTTTACTTTAGTATAGGCTTGTTTCGATGTGTC
CGAATGAAATTAATTATTCTTTATAATTCCATCTTTTCC
>LE_HBa0089E18_T7_25187 (trimmed for quality and cloning vector)
AGCTTTATTAAGAAGACAAACATGCAAATATTAATCTAAAAATTCAATTCTATATTGAGTTTTGAAATGCATATCAATGACAAATAGTTTAAGTGATTTA
ACATTATCATATAGTGGTTACATGTTACTATTTATTCTTAAATATTTTTTCCTTAAAATATTTTATAGGAGTTATTGCTTAGTATTTAATAAGATAACAT
TAATAAATTAAACACTTTGAAAGTCTGAATTATTCTCCTAATTCATTATTTAGCCATTATTATAATTAAAGTGAATGATGCATCAACCTGAAAAACATAC
TAATCTAAAAATAAAACTGTCGAGATATTGCTAAAAATTAAAATTAAAAAAGGATCTATAATTTTAATTCATCTTAAAATTAGTAGTGGTAATTTCAATT
TTTTATATAACCATATATTTTATAACATTCGATTTGATATAGAGACAAAATAGTAATCCAATAGAGAATTAAAGTAAGCCTTATGAGAAGTATTAAAATA
GAAATTCAACTAATTATCAAATTAAAAATTTAAGAAGCAGAAAATTAAATAACATGCAGAGAAAAAAATTACAACTAACTTATTGTTTAATTAATATTAA
CAGGAAGAAAAAGGAATTACAGCTAATACTTATTATTTAATTAATATAATATTTAACTATAGTATATGGACAACGACAAAATAATAATCCATCTTTGAGA
TTTTGATCTTTCCATTTTTTAATGTAGGAATTATTTTACATTGAAGAGCAAAATGATTGTTCATTCAACTTCTCAACTTTGGCTATTTAATATTTAATTA
ATTAGATATTTTATAATATTTTACTTTAGTATAGGCTTGTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.860751
Expected error %
0.341248
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0089E18
Clone
Clone name
hba-89e18
LE_HBa0089E18
C03HBa0089E18
P089E18
Clone type
BAC
Contamination
none
Estimated length
113,254
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found