Clone Read LE_HBa0089E23_SP6_25196

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0089E23_SP6_25196
Primer
SP6
ID from Seq. Facility
LE_HBa_089_E23-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
629 trimmed for vector and quality, 863 raw
Genbank Accession
Sequence
>LE_HBa0089E23_SP6_25196 (raw untrimmed)
GGCGAGGTTTTAGGGTCTGTTTTTTCCTTCAAGTAGTATAGAAAGAAGTACTNTGTTTTGATTTGATTAATGTTGATTCGTGGGGTTCTTATAAAACACC
CATTTTTATGGTAACAAGTACTTCCTTACAATGGTATTTCTACTTAAACGTAAGTTTAATATGTCTATTTCTCTTAAACTATTTATGCACTATGTTAGGA
CTCAATTAGGGAGAAATGTTAAGGCATTAAGGTTTGACAATGGGACTGAGTCTGCTAAGTATGTGCCCACTGCATTGTTCAAAGAGTTGGGAATCATACA
CGAGAGGTCTTGTCTATATACCCTTATCAAAATGGGGTTGTTTAGAGAAAACATAGACATATACTTGAGTAACTAGGGCACTCAAGTTGTATGCACACAT
TCCTTTGATGTTTTGGGGGGCACTATGTCTTAGTTGTAGTTTATCTAATCAACATATTATCAAGTAGTGTGATAGGACATCAAACTACTTCTGGGAAGTT
ATTATATGGAAACTAACCAGGTCTGTCTCATTTAAGGACATTAGGGTTCTTGTGCATTGCTAAGAATCTTACTAGACATGTTAAACTGATGGCAATATCA
AGGCCAGTTCTTCATATTGGAATATTCAGAAGCTAGAAGGGATACGTTCTTTTTTAACTGATCAATAGGACCTTATTTGTAAGAAGAGATGTCATCTTTA
AGGAAAACCATCCTATTTTTAACAAAAACCAGGCATCTTACAAAAAATCCTATATATGATATAGTGGGAAAACAATTTGTATACTTCAATTCAAAATACA
TTGTTTACAACCGAATGAACTACCATTATTCTGCAATGGTGATAAGGGTTGCCTTCTTTAAAT
>LE_HBa0089E23_SP6_25196 (trimmed for quality and cloning vector)
GTAGTATAGAAAGAAGTACTNTGTTTTGATTTGATTAATGTTGATTCGTGGGGTTCTTATAAAACACCCATTTTTATGGTAACAAGTACTTCCTTACAAT
GGTATTTCTACTTAAACGTAAGTTTAATATGTCTATTTCTCTTAAACTATTTATGCACTATGTTAGGACTCAATTAGGGAGAAATGTTAAGGCATTAAGG
TTTGACAATGGGACTGAGTCTGCTAAGTATGTGCCCACTGCATTGTTCAAAGAGTTGGGAATCATACACGAGAGGTCTTGTCTATATACCCTTATCAAAA
TGGGGTTGTTTAGAGAAAACATAGACATATACTTGAGTAACTAGGGCACTCAAGTTGTATGCACACATTCCTTTGATGTTTTGGGGGGCACTATGTCTTA
GTTGTAGTTTATCTAATCAACATATTATCAAGTAGTGTGATAGGACATCAAACTACTTCTGGGAAGTTATTATATGGAAACTAACCAGGTCTGTCTCATT
TAAGGACATTAGGGTTCTTGTGCATTGCTAAGAATCTTACTAGACATGTTAAACTGATGGCAATATCAAGGCCAGTTCTTCATATTGGAATATTCAGAAG
CTAGAAGGGATACGTTCTTTTTTAACTGA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.952842
Expected error %
0.387076
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89728.1| Score 52 E Value 7e-11 Identity 32.50% Align. Length 454bp (72.18%) Frame 1
putative retroelement pol polyprotein-like [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT40538.1| Score 46 E Value 4e-11 Identity 31.50% Align. Length 544bp (86.49%) Frame 1
hypothetical protein PGEC407.4 [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0089E23
Clone
Clone name
hba-89e23
LE_HBa0089E23
P089E23
Clone type
BAC
Contamination
none
Estimated length
131,634
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found