Clone Read LE_HBa0006E18_SP6_2530

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0006E18_SP6_2530
Primer
SP6
ID from Seq. Facility
LE_HBa_006_E18-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
877 trimmed for vector and quality, 992 raw
Genbank Accession
Sequence
>LE_HBa0006E18_SP6_2530 (raw untrimmed)
AAAAAAAAAATGTTTTTCTTTTGCTATTGATCATCGGTTTGGCGTGACGTGCCTCTTGTGTTTCTGCCGTCGGTGTTTTCCTTTTATTATCTCGCGTTAG
GGGATTGACACGCTACCAGTGCGCCAAAAACGAGCCTATGAACTTTTCCTTTGCCATGGCCCATCTGGATTTTATCAAAACACCATATGGATACATATTT
CCTCTATTTCTGGGCACTTTCTTCCCCTTTGACCTGCACGTCAACCACACAACGTGACCTAATAATGGTTGTTGCCTCCCAACCAGCACCTTAGATTTGT
TTATGGCATGATCATCTTTTTGCATTTTTTGTTTTAATATCTTAAGTACTATTGAACTAACACTAGAAAAGCATAAAAAAAACTACACCTAAGAATTTAA
AATTAAGCTAAACTTACAAAATTAAACGAGACTACTACATTTTACATAGGATTCACGGTTACCTCCCATGTAGTAATTGATTTAATGTCGCGGCACGATG
CAGCTTCGATCATTTATCATTTAGATCAATAGCATCCCGATCAAGATCCGAATCAACACCAAAGTAATGTTTTACTCTTTGCCCATTCACCAAGAACGTA
GAACCAGTCTTTCCATTTAGTTCCACAGCCCCATGTTGCATCATTCTTACAACTTCAAAGGGAACATTTCATTTCGACCTTAGTTTTTTCCGGGGAATAA
CCTAAGTCTAGAGTTAAAGAGTAGTACCTTCTCTCCCGGATTAAAGGTTCGGGCTACTATGTGCTTATCATGCCACCTCTTCTTCTTTTCTTTATATAGC
TTGGCATTCTCATATGCGTGGTGTAGAAACTCTTCAAGTTCATGCAACTGGTTCACTCTTTTTCTACCGGCTAGCTCAGGTTCCAAGTTCACTTCTTAAT
GTCCACAAGCTCGATGTTCTATTCTATGAAAATGATTTTCAATACCATAAGATTTATTTTGTATTTTCTAAAAAATATTAATTATGGATTTG
>LE_HBa0006E18_SP6_2530 (trimmed for quality and cloning vector)
CGGTTTGGCGTGACGTGCCTCTTGTGTTTCTGCCGTCGGTGTTTTCCTTTTATTATCTCGCGTTAGGGGATTGACACGCTACCAGTGCGCCAAAAACGAG
CCTATGAACTTTTCCTTTGCCATGGCCCATCTGGATTTTATCAAAACACCATATGGATACATATTTCCTCTATTTCTGGGCACTTTCTTCCCCTTTGACC
TGCACGTCAACCACACAACGTGACCTAATAATGGTTGTTGCCTCCCAACCAGCACCTTAGATTTGTTTATGGCATGATCATCTTTTTGCATTTTTTGTTT
TAATATCTTAAGTACTATTGAACTAACACTAGAAAAGCATAAAAAAAACTACACCTAAGAATTTAAAATTAAGCTAAACTTACAAAATTAAACGAGACTA
CTACATTTTACATAGGATTCACGGTTACCTCCCATGTAGTAATTGATTTAATGTCGCGGCACGATGCAGCTTCGATCATTTATCATTTAGATCAATAGCA
TCCCGATCAAGATCCGAATCAACACCAAAGTAATGTTTTACTCTTTGCCCATTCACCAAGAACGTAGAACCAGTCTTTCCATTTAGTTCCACAGCCCCAT
GTTGCATCATTCTTACAACTTCAAAGGGAACATTTCATTTCGACCTTAGTTTTTTCCGGGGAATAACCTAAGTCTAGAGTTAAAGAGTAGTACCTTCTCT
CCCGGATTAAAGGTTCGGGCTACTATGTGCTTATCATGCCACCTCTTCTTCTTTTCTTTATATAGCTTGGCATTCTCATATGCGTGGTGTAGAAACTCTT
CAAGTTCATGCAACTGGTTCACTCTTTTTCTACCGGCTAGCTCAGGTTCCAAGTTCACTTCTTAATGTCCACAAGCT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.972653
Expected error %
0.151719
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAQ82031.1| Score 86 E Value 2e-24 Identity 56.50% Align. Length 376bp (42.87%) Frame 3
pol [Pisum sativum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_471020.1| Score 78 E Value 3e-21 Identity 55.40% Align. Length 373bp (42.53%) Frame 3
OSJNBb0060M15.10 [Oryza sativa (japonica cultivar-group)] emb|CAE03198.2| OSJNBb0060M15.10 [Oryza sativa (japonica cultivar-group)] emb|CAE01641.2| OSJNBb0021I10.3 [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0006E18
Clone
Clone name
hba-6e18
LE_HBa0006E18
C04HBa0006E18
P006E18
Clone type
BAC
Contamination
none
Estimated length
125,909
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found