Clone Read LE_HBa0116C14_T7_253191

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0116C14_T7_253191
Primer
T7
ID from Seq. Facility
LE_HBa_116_C14-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
606 trimmed for vector and quality, 970 raw
Sequence
>LE_HBa0116C14_T7_253191 (raw untrimmed)
CCGTCGGGGATCTNAGAGTCGACTGCAGGCATGCAAGCTTCTTAAAAGATGTAATTAAATTATATTTAAGTGAAATTAGTGAAGTAAAGATCTTGAAATT
AAGTTCAAAAACCAATTTAAAATTTTGATTTTGACACAGAATTGCAGTCCAGTTTCTAATTCAATTACTATTACTAGTATTGATCGCTAAATATTTTGTC
CTAAAATGTAGGAAGTTCATAAATAATGTTCCCTCAACAATTAGTTTATTTTCTAATTGTGTTTGTTGTTTTCTGAACAATTGAATCGAGGCTTTGGAGG
AGAATTTCCATTTAATCTTGTGAACGAAATTGGTAAAAGAGATACAAACGGAGAGGAATAATAACCATAACCAATTAATGAGAGAACAACGGAACAATCA
AGAACCCGAATAGAGACTCCCCAAAATGATGGGGAAGAGAGCGGCCACTAAACAGTTTCTTTAGAAAAGCCACCTGCCCCAAAATCATGTATTAAGATAA
CCATTCTTTCCTTCTATATTTTATCGGTAATGAGGTGTCTCACAGTCTTTTTCAAGCGTTAGAGGGTATTGAGAAGGAAGTAGAGATCCCTTTAAAAGCC
ATAAGCCAGCATATCTTTCTTACATATTCAAAGATGGGCAGATGAGACCCTGTTGAGATTCATTCCTCGAATAATCTAGGAGCGAATAAGACTTATGGAA
ATGACAACCAAATATCGTTTAAAAAAGGTTACACCAAAAATCATGATCAATTTCTAACCGAACCTCCAAAAAAACATCAACTTCCCTTCGAAAAATCTGG
TTTTCCTTTTCTTCCCAAATGGCCACCCCTCCTAAAAAAAAAAGACCCCTGTGAATGAAGCAATTAGCTTTTAACCCCCTTAACCCCCTTTAAAACCAAA
CACTTTGGGGTCGCTGGCTAAAATGGAAAAGGGTAGCCGATAAAACCCAAAATTTCCCCCCAGGCCTCCG
>LE_HBa0116C14_T7_253191 (trimmed for quality and cloning vector)
GCAGGCATGCAAGCTTCTTAAAAGATGTAATTAAATTATATTTAAGTGAAATTAGTGAAGTAAAGATCTTGAAATTAAGTTCAAAAACCAATTTAAAATT
TTGATTTTGACACAGAATTGCAGTCCAGTTTCTAATTCAATTACTATTACTAGTATTGATCGCTAAATATTTTGTCCTAAAATGTAGGAAGTTCATAAAT
AATGTTCCCTCAACAATTAGTTTATTTTCTAATTGTGTTTGTTGTTTTCTGAACAATTGAATCGAGGCTTTGGAGGAGAATTTCCATTTAATCTTGTGAA
CGAAATTGGTAAAAGAGATACAAACGGAGAGGAATAATAACCATAACCAATTAATGAGAGAACAACGGAACAATCAAGAACCCGAATAGAGACTCCCCAA
AATGATGGGGAAGAGAGCGGCCACTAAACAGTTTCTTTAGAAAAGCCACCTGCCCCAAAATCATGTATTAAGATAACCATTCTTTCCTTCTATATTTTAT
CGGTAATGAGGTGTCTCACAGTCTTTTTCAAGCGTTAGAGGGTATTGAGAAGGAAGTAGAGATCCCTTTAAAAGCCATAAGCCAGCATATCTTTCTTACA
TATTCA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.941727
Expected error %
0.133058
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0116C14
Clone
Clone name
hba-116c14
LE_HBa0116C14
C09HBa0116C14
P116C14
Clone type
BAC
Contamination
none
Estimated length
101,670
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found