Clone Read LE_HBa0116G06_T7_253362

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0116G06_T7_253362
Primer
T7
ID from Seq. Facility
LE_HBa_116_G06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
614 trimmed for vector and quality, 1007 raw
Sequence
>LE_HBa0116G06_T7_253362 (raw untrimmed)
AGTGACGGGGATCTCAGAGTGACCTGCAGGCATGCAAGCTTGAAGATGATTTTGATGCGTTTACTTCTGCTAAGTCTTCTGATTTGGCTCAGCCACTTGT
TGAGGCGCAAATTCCGTACAAAATTCATATTGTGAAGGATCATGATATGAAGGAAAGGCTATGTCTTGAGGTTGAGAGGCTAGGATTGAGTGCAGTTATC
ATGGGTAGTCGAGGATTCGGGGCTACTAAGAGAGGAAATGATGGGAGGCTTGGAAGTGTTAGTGATTACTGTGTTAGGCATTGTGTTTGCCCTGTTGTGG
TTGTGAGGTATCCTGATGAGAAGGATGGTGGAAATGCTGCTCGTAAGGGCGGAGTTCCTGTGGCATCTGCCTCAAAAGAAAACGAGGAGGAAGGCGAGTA
CCATGATGCTTGTGATGGTCGTCAAGGTATGTGCAAAATTCATCCTAATGTTTGCTTAGTTATTTTCGGGTCTTTATATGTAAATTTATGCAATTTGCTG
CTGGTTATCAGTTTGTTCCATTTTCTAATTGAAATGAAAGACCCTTTCATGTTTTATAATGTAAAATGTGGCACACTGCTGTCAACTCTGTGATTTGGCT
GTGTGTTATACCAAAAGGAAAATTAGGTGGGTACTCCCCCAAGTAGTCACATTCCAGAAAGGTAATGCCTGTTTACGTTTATGCATATGAATTTGACATG
CAATACAGTGCAGGAAATCCCGTGATACTTTGTACAATTATTAATATTGTTTGGCAACCAATATCCTTAGAAGTATATAGCCTTTAAAAATTTCCAAAAT
TGTGAGTTGCATTTTTTTGAAAAAAGGGAATAAAAGGACCCCCGGGTTAAAATTGGGAAACTGAAACTGAAAGACACCCTCCTTGAAAAACTTATTTTTT
ACAAATTGCCTAAACCTTGTGGTTTGGAAACCCGGAGGGCCCATTTTGTTTTAAATTTGTCACTTCCCCCCTGAAAGAGGGAATCTCCATCCCACCCTTA
GGAAAAG
>LE_HBa0116G06_T7_253362 (trimmed for quality and cloning vector)
CTGCAGGCATGCAAGCTTGAAGATGATTTTGATGCGTTTACTTCTGCTAAGTCTTCTGATTTGGCTCAGCCACTTGTTGAGGCGCAAATTCCGTACAAAA
TTCATATTGTGAAGGATCATGATATGAAGGAAAGGCTATGTCTTGAGGTTGAGAGGCTAGGATTGAGTGCAGTTATCATGGGTAGTCGAGGATTCGGGGC
TACTAAGAGAGGAAATGATGGGAGGCTTGGAAGTGTTAGTGATTACTGTGTTAGGCATTGTGTTTGCCCTGTTGTGGTTGTGAGGTATCCTGATGAGAAG
GATGGTGGAAATGCTGCTCGTAAGGGCGGAGTTCCTGTGGCATCTGCCTCAAAAGAAAACGAGGAGGAAGGCGAGTACCATGATGCTTGTGATGGTCGTC
AAGGTATGTGCAAAATTCATCCTAATGTTTGCTTAGTTATTTTCGGGTCTTTATATGTAAATTTATGCAATTTGCTGCTGGTTATCAGTTTGTTCCATTT
TCTAATTGAAATGAAAGACCCTTTCATGTTTTATAATGTAAAATGTGGCACACTGCTGTCAACTCTGTGATTTGGCTGTGTGTTATACCAAAAGGAAAAT
TAGGTGGGTACTCC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.957556
Expected error %
0.133658
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g11360.2 Score 142 E Value 1e-34 Identity 21.30% Align. Length 380bp (61.89%) Frame 2
68414.m01305 universal stress protein (USP) family protein contains Pfam PF00582: universal stress protein family domain; similar to ethylene-responsive ER6 protein (GI:5669654) [Lycopersicon esculentum]
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g11360.1 Score 142 E Value 1e-34 Identity 21.30% Align. Length 380bp (61.89%) Frame 2
68414.m01304 universal stress protein (USP) family protein contains Pfam PF00582: universal stress protein family domain; similar to ethylene-responsive ER6 protein (GI:5669654) [Lycopersicon esculentum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
pir||F86247 Score 142 E Value 5e-33 Identity 21.30% Align. Length 380bp (61.89%) Frame 2
protein T23J18.3 [imported] - Arabidopsis thaliana gb|AAF16649.1| T23J18.3 [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_849638.1| Score 142 E Value 5e-33 Identity 21.30% Align. Length 380bp (61.89%) Frame 2
universal stress protein (USP) family protein [Arabidopsis thaliana] ref|NP_563888.2| universal stress protein (USP) family protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0116G06
Clone
Clone name
hba-116g6
LE_HBa0116G06
C10HBa0116G06
P116G06
Clone type
BAC
Contamination
none
Estimated length
136,578
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found