Clone Read LE_HBa0116G09_T7_253368

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0116G09_T7_253368
Primer
T7
ID from Seq. Facility
LE_HBa_116_G09-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
576 trimmed for vector and quality, 996 raw
Sequence
>LE_HBa0116G09_T7_253368 (raw untrimmed)
ATGGTCCGGGGATCTCAGAGTCGACCTGCAGGCATGCAAGCTTGCAAAAAAGTCAAAGGAGGCAGTCTTTGACACATGAGAACTTAAACAAGAGGAAGCC
CAATCTACATTCTAGTTGCTATTTATGTGAAGAACAGGTGGAGACAGTCAACCATCTTTTTTTACACTGCAAATGGACAGATCAATTGTGCCAAAAGAGG
AAGATCAAGTGGACAAAGCTTGGGAGAATTATAAAAGTCCTAAAATGCTGGAACAGGGATGGGATGGAAATGCAGGAAAGAAAGAGAAGAGATGAAGGAT
TGTCCCAGCTTGCATTTGGTGGAGAATTTGGAAGAAAAGGAATCAAAGATGTTTTGAAGGAAAACAGAACAATATCCAGAAGATAAAGACAAATTGCCTA
GGGCTTTCTATTTTTGGTAAGCAAGTAGTAATAGGGGATGCTGAAAATGTGTTTAATATCATTGACTGGCTTCTGGTGGTAACTAGAAGATGTTATAAAT
GATGTAAGTAAAACTTTTTGGAGGGGGACTACACTTTGATGTAGTATACCTGTGGATATATAGAAGTAAATGTTACCTCTCTTTAAAAAAAAGATATGTA
AGTACTAACACCTAAGGGAGGTATCATATTGCGGAATTACATTAAAGGAGGCTTAATGGTGCCCAAATCACACCACGCAAGTGTACGTAGTCGTTCCAGT
ATTAAAGGGGTTTTTACACCGGATTGTCTACCACAGGGACTCACGATTAAAATCACTTAATTTTCCCTAAAACTTTCAGCTTAACACAAATGGTTTTCCG
TATTCGAGAGGGATTTTTTTTTTTAAATCAAATGTTTAAAAAAAAATTAACCAATAGCCGATCCACTTTCAAAGGGTTCCCAATAAAAATAGGGAAAAAG
CCCAGGGGTGCCATTCTTTTCCCGGAGCCCAGCAAATTTAAGCCAACTTAAAAGGGGTGGTTTCCCACTTTCAAAAATAATGGAACAACGGGTCCC
>LE_HBa0116G09_T7_253368 (trimmed for quality and cloning vector)
CTGCAGGCATGCAAGCTTGCAAAAAAGTCAAAGGAGGCAGTCTTTGACACATGAGAACTTAAACAAGAGGAAGCCCAATCTACATTCTAGTTGCTATTTA
TGTGAAGAACAGGTGGAGACAGTCAACCATCTTTTTTTACACTGCAAATGGACAGATCAATTGTGCCAAAAGAGGAAGATCAAGTGGACAAAGCTTGGGA
GAATTATAAAAGTCCTAAAATGCTGGAACAGGGATGGGATGGAAATGCAGGAAAGAAAGAGAAGAGATGAAGGATTGTCCCAGCTTGCATTTGGTGGAGA
ATTTGGAAGAAAAGGAATCAAAGATGTTTTGAAGGAAAACAGAACAATATCCAGAAGATAAAGACAAATTGCCTAGGGCTTTCTATTTTTGGTAAGCAAG
TAGTAATAGGGGATGCTGAAAATGTGTTTAATATCATTGACTGGCTTCTGGTGGTAACTAGAAGATGTTATAAATGATGTAAGTAAAACTTTTTGGAGGG
GGACTACACTTTGATGTAGTATACCTGTGGATATATAGAAGTAAATGTTACCTCTCTTTAAAAAAAAGATATGTAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.934905
Expected error %
0.197909
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0116G09
Clone
Clone name
hba-116g9
LE_HBa0116G09
C03HBa0116G09
P116G09
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found