Clone Read LE_HBa0116P23_T7_253721

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0116P23_T7_253721
Primer
T7
ID from Seq. Facility
LE_HBa_116_P23-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
446 trimmed for vector and quality, 984 raw
Sequence
>LE_HBa0116P23_T7_253721 (raw untrimmed)
ATCCTGTCGGGGATCTCTGAGTGACCTGCAGGCATGCAAGCTTTTGATTTCAGTATTAATAATTAATGTGGAGTTTTTACAAGAATACATAGAGTAGGTG
AGGAATGTTTTCAAGTGATAATAATTAATCTTGAATTTTTACAAAAATACATAGAGTATGTAAGGAACATGAGTTAAATTTATTAAATTGGATTGAACTC
TTATTTTATGGCTATATTTCATCTTATTTGTATTAATTTTGATATTTTCATTTTATGTGAAGGTGTTACGATTTTTAGGATTAATTATTTTTCTTTTTAA
ATAATTTTCACATTTTTAAAATAATATTTTAAATTATTATTTACGTTAAGTTACACTATTTTTTTATATTTTTAAATATATAAATTTTATTTTAGAAATA
ACAACGTATATATGTAATTTTACTAAAGAATTTTAAGAAGTGAAAATAAACAAATTGTTTTCAAAAAGATTTTAGATCAAGTAAAACAATATAAAACGAA
TTTAAAAAGAACAATACCTAATTATAAAAAAATCGTTCTTCCACATTTATAAATAACAGAGCATTATGATCATGCAGAAAGGTAAGGAATCAGCAAGAAT
TTCCCCATCATTGACAATAACCTTTGAATTCACATTATCTCTGTACAGAAATCACCCTAACTCCGCTACGCTTTCTCTAACTCTCATCTCGAAATGTCTC
ATTCTCTCATTTCTTCACAAATTTCTCTTTCTACTTTCACTTCTTCAACCCACTACTTATTTTTCACCCTAATCATCCCAGTCACATCACATTTCTCCTC
TCTTCCATGCAGAAAACAAACTCCCCTCATTTGCTCTTCTCATCAACTTACTTAACCTCTCTAACACTCATTCTATGTATCGTCATCTCATGATCAATTT
CCTCCATAATCCTCTGCAATATATCTAATGCACCATCTCGCCGCCCTACTATACTCACTTCATCCTAACTTACCTCTCTTTTAG
>LE_HBa0116P23_T7_253721 (trimmed for quality and cloning vector)
CCTGCAGGCATGCAAGCTTTTGATTTCAGTATTAATAATTAATGTGGAGTTTTTACAAGAATACATAGAGTAGGTGAGGAATGTTTTCAAGTGATAATAA
TTAATCTTGAATTTTTACAAAAATACATAGAGTATGTAAGGAACATGAGTTAAATTTATTAAATTGGATTGAACTCTTATTTTATGGCTATATTTCATCT
TATTTGTATTAATTTTGATATTTTCATTTTATGTGAAGGTGTTACGATTTTTAGGATTAATTATTTTTCTTTTTAAATAATTTTCACATTTTTAAAATAA
TATTTTAAATTATTATTTACGTTAAGTTACACTATTTTTTTATATTTTTAAATATATAAATTTTATTTTAGAAATAACAACGTATATATGTAATTTTACT
AAAGAATTTTAAGAAGTGAAAATAAACAAATTGTTTTCAAAAAGAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.837051
Expected error %
0.343808
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0116P23
Clone
Clone name
hba-116p23
LE_HBa0116P23
C03HBa0116P23
P116P23
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found