Clone Read LE_HBa0125F09_T7_253920

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0125F09_T7_253920
Primer
T7
ID from Seq. Facility
LE_HBa_125_F09-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
10 trimmed for vector and quality, 985 raw
Sequence
>LE_HBa0125F09_T7_253920 (raw untrimmed)
TTTTCCCNNNGGCGCGGACGGGGATCTCTGAGNTGACCTGCAGGCATGCAAGCTTGAGTATTCTATAGTGTCACCTAAATAGCCTTGGCGTAATCATGGT
CATAGCGTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCGCTGGGGTGCCTAATGAGTG
AGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCTTG
CGGCCGCCCGGGCCGTCAACCATTTCTCATGTTTGACAGCTTATCATCCAATTTCTGCCATTCCTCCGCTTATTATCACTTATTCAGGCATAGCAACCAG
CTCTTTAAGGGCACCAAGAACTGCCTTAAAAAAATGACGCCCCTCCCTGCGACTCATCGCATTTACTCTTGTAATTCATTAAGCATTCTGCCGACTTGGA
AGCCATCACAAACTGCATGAGGAACCTGAATCGCCAGCGGCATCAGCACCTTGTTGCCTTGCGTATAATATTTGCCCATGGAGAAAACTGGGGCTTATGA
AGTTGTCCATATTGTCCACGTCTAGATCCAAACAGATGAAGCTCACCCTGCGATTGTGTGAGACTATAAACAATTTCTCATTAAGCCTCTAGGGAAATAG
GCCAGGTTTTCACCGTGACACGCAACTCATGGCAATACATGTGTAGAAACTGTCCGGAATCCTCGTGGTTTTCAATCCAAAGGCTACGAAACGTATCAAT
TTGCTCATGGTAAACGGGGTAACCAAGGAGTAGCTCTATCCCTTAACACGGTCTCAACGGCTTTGCATGCCATTTCGAATTCCCGAGGAACCTTCCATCG
GGCGGGCCAGAATGTTAAAAAAGGGCGGATTAAAACTTGGGCTAATAATCTTCTCGGGGCATTTAAAAGGCGTAATTTCCAACCC
>LE_HBa0125F09_T7_253920 (trimmed for quality and cloning vector)
CAGGCATGCA

This is probably not a useful sequence.

Problems:
  • Low complexity
  • Short cloning insert
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, short insert
Quality trim threshold
14.5
Sequence entropy
not recorded
Expected error %
3.32599
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0125F09
Clone
Clone name
hba-125f9
LE_HBa0125F09
P125F09
Clone type
BAC
Contamination
none
Estimated length
61,495
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found