Clone Read LE_HBa0125H08_T7_253993

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0125H08_T7_253993
Primer
T7
ID from Seq. Facility
LE_HBa_125_H08-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
525 trimmed for vector and quality, 949 raw
Genbank Accession
Sequence
>LE_HBa0125H08_T7_253993 (raw untrimmed)
NTTCACGACGGGGACTCAGAGCGACCTGCAGGCAGCAAGCTTTGGAGAAATTTGCTTGCTTGATCACTAATCTTTGGTGGAGGTAGGCTATGGTTTTTAT
GCTTTGATAGTAAACTCTTAATAGAGAATGATATGTATTGGGTAGTATTGTAAACCCTTCTATGTGCTTAATTGTATGCATGCATGAATGTGATTATATG
ATTGTGATGAAATAAGCATGATGAAGCGATTGAATCCCAAATCATGATAAAAACCCAATCTCTTGTTAATGATGATGCCTTGGTATAAAAGAAGGCTTGA
TGAACTAAAGTAATGAGATGGATGATGTCTTGGTATAAAAGAAGGCTTGATTAACTAAAGTAATGAGATTGATGATGCCTTGGTATAAGAGAAGGCTTGA
TGAATTGATAGAATGAGATTAGGGGATCGGGTGTCACGAACCAAAACGTAGATTTAGGGGATCGGGTGTAACGAACTGACACATAGATTTAGGGGATCGG
GTGTCACGAACCGACACGTAGAATTAAGGGATCGGAGTGTCACGTTCCGACGCATAGTAGTAAGGGAGCGGAGTGTCACGTACCGATACAAGAGGAATAA
AGATAATGAATCTGGAAAGATGTTAATATACTCAATTTAAGGAATCTAATTTCCGAATGAGTATGGTATTGAGGCATGAGTCCTCCTGGGTGAACTTGAC
GAAAATTGTTAATGATGTACTCCTTGTTGTTCCTCCCATGTCAATAGCATAGATGAATTTATGATTGAACTTGGCTTTGTACGGTTTCTGATTTTAAATT
AGCAAATAATATCCGCCCCTTACCCAAAATTTCAGCACACCCCGACCTTCAATGTTTACTATCCGAAACAAGAAAAAAACGGAGAAATTTTCACACGGTT
TCCAAACAAACCACATTTAGAAGCTATTCATAATCACCTCCATATTCAA
>LE_HBa0125H08_T7_253993 (trimmed for quality and cloning vector)
CCTGCAGGCAGCAAGCTTTGGAGAAATTTGCTTGCTTGATCACTAATCTTTGGTGGAGGTAGGCTATGGTTTTTATGCTTTGATAGTAAACTCTTAATAG
AGAATGATATGTATTGGGTAGTATTGTAAACCCTTCTATGTGCTTAATTGTATGCATGCATGAATGTGATTATATGATTGTGATGAAATAAGCATGATGA
AGCGATTGAATCCCAAATCATGATAAAAACCCAATCTCTTGTTAATGATGATGCCTTGGTATAAAAGAAGGCTTGATGAACTAAAGTAATGAGATGGATG
ATGTCTTGGTATAAAAGAAGGCTTGATTAACTAAAGTAATGAGATTGATGATGCCTTGGTATAAGAGAAGGCTTGATGAATTGATAGAATGAGATTAGGG
GATCGGGTGTCACGAACCAAAACGTAGATTTAGGGGATCGGGTGTAACGAACTGACACATAGATTTAGGGGATCGGGTGTCACGAACCGACACGTAGAAT
TAAGGGATCGGAGTGTCACGTTCCG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.94399
Expected error %
0.181312
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0125H08
Clone
Clone name
hba-125h8
LE_HBa0125H08
P125H08
Clone type
BAC
Contamination
none
Estimated length
79,127
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found