Clone Read LE_HBa0125O10_T7_254228

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0125O10_T7_254228
Primer
T7
ID from Seq. Facility
LE_HBa_125_O10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
608 trimmed for vector and quality, 931 raw
Genbank Accession
Sequence
>LE_HBa0125O10_T7_254228 (raw untrimmed)
NGTGGGTCGGGGATCTCTGAGTCGACCTGCGGCATGCAAGCTTTCAGATTTGAATAATCAGCAGCTTTTCCTGACCACATCTCCATAGGTGTCTTGCACT
GTATGCCTGTATGTGGTCCACGGTTAATCAAGTAGCAAGCTGTACTAACCGCTTCTGCCCAGAATCTTCTATCTAGCCCAGTATTAGAGAGCATGCACCT
TGCTCTCTCCAGAAGTGTTTGATTCATCCTCTCAGCTACACCGTTCTGCTGTGGTGTATTTCTGACTGTACGATGTCGAGCAATCCCTTCATCCTTACAG
AATTGATCAAACTCAGACCAGCAGAATTCCAGCCCATTATCAGTTCGCAACCTCTTGATCTTCTTCCCTATTTGATTTTCCATCAAAATTTTCCACTCCT
TGAACTTCTGGAAAGCTTCACTTTTATGCTTCATCATGTACACCCAAGTCATCCTTGAGTAGTCATCAATAATGGACACAAAAAATCTGCAGCCTCCCAA
AGACTCAACACGGCATGGACCCCGGCAATCAGAATGGATGTAATCAAGTGTGCCTTTTGTTCTGTGAATGGCCTTTGGAAACTTGTTGCGATGTGGTTTT
TCCAAGACACATTGTTCGCAAAACTCTAGGATCTTAACCTTATGACCAACAAGAAGATCCTCCTTTGACAGAATTTGCATCCCTCTTTCACCATATGACC
AAGTCTCATGTCCCATAACTTAGTCATATCCTCCCTGGTGAACTTCTGACGAAGCAACAGGGGCTGAACCTGTAACCGGGGAACCTTGTAGAAATTACAA
AGTTCCCCGCCTGACACCTTTCGAAATCAAATTTGAAACCCTTTCCGGCCCCTTAAGACATCCTTTTTTTTCGGACCAAGGGAATCCCCTGGCGGCCCAA
AAAACGGGGAAATTTTCAATTTTTCCCTTCC
>LE_HBa0125O10_T7_254228 (trimmed for quality and cloning vector)
GGCATGCAAGCTTTCAGATTTGAATAATCAGCAGCTTTTCCTGACCACATCTCCATAGGTGTCTTGCACTGTATGCCTGTATGTGGTCCACGGTTAATCA
AGTAGCAAGCTGTACTAACCGCTTCTGCCCAGAATCTTCTATCTAGCCCAGTATTAGAGAGCATGCACCTTGCTCTCTCCAGAAGTGTTTGATTCATCCT
CTCAGCTACACCGTTCTGCTGTGGTGTATTTCTGACTGTACGATGTCGAGCAATCCCTTCATCCTTACAGAATTGATCAAACTCAGACCAGCAGAATTCC
AGCCCATTATCAGTTCGCAACCTCTTGATCTTCTTCCCTATTTGATTTTCCATCAAAATTTTCCACTCCTTGAACTTCTGGAAAGCTTCACTTTTATGCT
TCATCATGTACACCCAAGTCATCCTTGAGTAGTCATCAATAATGGACACAAAAAATCTGCAGCCTCCCAAAGACTCAACACGGCATGGACCCCGGCAATC
AGAATGGATGTAATCAAGTGTGCCTTTTGTTCTGTGAATGGCCTTTGGAAACTTGTTGCGATGTGGTTTTTCCAAGACACATTGTTCGCAAAACTCTAGG
ATCTTAAC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.974564
Expected error %
0.293143
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAP53216.1| Score 255 E Value 6e-67 Identity 19.30% Align. Length 596bp (98.03%) Frame 1
putative retroelement [Oryza sativa (japonica cultivar-group)] ref|NP_920929.1| putative retroelement [Oryza sativa (japonica cultivar-group)] gb|AAM10749.1| Putative retroelement [Oryza sativa] gb|AAM08562.1| Putative retroelement [Oryza sativa]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAX92941.1| Score 254 E Value 1e-66 Identity 19.60% Align. Length 587bp (96.55%) Frame 1
retrotransposon protein, putative, Ty1-copia sub-class [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0125O10
Clone
Clone name
hba-125o10
LE_HBa0125O10
P125O10
Clone type
BAC
Contamination
none
Estimated length
102,979
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found