Clone Read LE_HBa0140H01_T7_254523

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0140H01_T7_254523
Primer
T7
ID from Seq. Facility
LE_HBa_140_H01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
586 trimmed for vector and quality, 953 raw
Genbank Accession
Sequence
>LE_HBa0140H01_T7_254523 (raw untrimmed)
ATGGGTCGGGGTCTCTGAGTCGACCTGCGGCATGCAAGCTTTAGAGAAGGTAGCGTGGTGGTTCCATTATCCGCGGAGTTTCGAACCATGTGGCCATTGA
TCCCTCGGGTAGTTGGTTATTAAAGAAGTTAGATATTAACTTATTAATTGTTGGAGCATAAATGATTTCTTCCGAACTATAGCTAGAATCTAGATTGTTG
AGTACCGTTTTCTTGTTTCAATATTTCCCCTGTATGTGGATGTATTCATATATGGCTTTTCATTCTTGTTCGAGTCATGTTCAAAAACATCTTAGATGTT
TGATTCTCTGTCAAATCCTATTTCGAAGGAGTGAATGGGTTAATTTTAAATTCTGAGGCAAGTTCTGTTATGGAAAAGGTTTACTAAATAGCTCAATGTA
GCAGAGTCTAGGAGACTCTAATGCCTTTGGTCTTTTTATTTTCTTAGTCCCTTCTAACATGATTTATGATGTCTTCCTCCTATGGGGCAATGTGTCCTTG
TTCATACTAATAACCAGACTTTTATCAAGCACTCTCTTTTGGCAATTTGATCTTTTATCAGACACTCCTATCAGCCTATCCTTTTCTTCCAAGGCACATA
TCTCCCAGGAACAAAAAAATATTGGATTCTAGGTGAAGGGTTGTCGCTGAACAAGTTATTGCTTATCATGTCTTTATTGACAAATAAAGAGAAAAAGGAG
GGATATAGGGGCATTTTGCTATTTAATACTAACCTTCCTCCCCCAGTACACTTTGGTGTCCTAATTGGGTTATTCCCCAAGTTTGGAAACAATCTTTGCT
TCTACATCTGGTGCCCATTTCCTTGGCTGCCAGAAGGTCATATTAAATTCTCCAAATCCATATCCTTTTCTTAGTATGAGAATTAGAAGTGTGCCCTCTT
ATCTTCGCTTTATATTTTACTATAGCGATCTTTCTTGCCGAATTTTCTTAATC
>LE_HBa0140H01_T7_254523 (trimmed for quality and cloning vector)
GAGTCGACCTGCGGCATGCAAGCTTTAGAGAAGGTAGCGTGGTGGTTCCATTATCCGCGGAGTTTCGAACCATGTGGCCATTGATCCCTCGGGTAGTTGG
TTATTAAAGAAGTTAGATATTAACTTATTAATTGTTGGAGCATAAATGATTTCTTCCGAACTATAGCTAGAATCTAGATTGTTGAGTACCGTTTTCTTGT
TTCAATATTTCCCCTGTATGTGGATGTATTCATATATGGCTTTTCATTCTTGTTCGAGTCATGTTCAAAAACATCTTAGATGTTTGATTCTCTGTCAAAT
CCTATTTCGAAGGAGTGAATGGGTTAATTTTAAATTCTGAGGCAAGTTCTGTTATGGAAAAGGTTTACTAAATAGCTCAATGTAGCAGAGTCTAGGAGAC
TCTAATGCCTTTGGTCTTTTTATTTTCTTAGTCCCTTCTAACATGATTTATGATGTCTTCCTCCTATGGGGCAATGTGTCCTTGTTCATACTAATAACCA
GACTTTTATCAAGCACTCTCTTTTGGCAATTTGATCTTTTATCAGACACTCCTATCAGCCTATCCTTTTCTTCCAAGGCACATATC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.956012
Expected error %
0.14207
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0140H01
Clone
Clone name
hba-140h1
LE_HBa0140H01
P140H01
Clone type
BAC
Contamination
none
Estimated length
27,194
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found