Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

Clone Read LE_HBa0140O20_T7_254805

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0140O20_T7_254805
Primer
T7
ID from Seq. Facility
LE_HBa_140_O20-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
608 trimmed for vector and quality, 930 raw
Genbank Accession
Sequence
>LE_HBa0140O20_T7_254805 (raw untrimmed)
NTGCTGTCGGGGATCTCTGAGTCGACCTGCAGGCATGCAAGCTTCCTGATAGCTGAAGTCATGGCGGCTAAAGGTTATAAAGTGCAGCCACTTTGCCGGA
TCAAGCGTCATGACACAGTGCAGGTTTGTTCGTCACATCTTGCATTTGTCTAGGCATATACAAGTCCTTGTATTGCTTACTGTCGAAGAATGCCCATCTG
TTTGAAAAAATGGTCCTAAAGTGTACCACCCACCATTCAATCACACTTCCTCATTCAATGAGCATCGTTACTATCTTTGTGTTTCTTCTATGAATTATAT
CACTATATCAAGTATATAATGGTGCTTTCAGACGTGTGCGGGTATTTTAAAGCAGTCATTGCTGGATTTCACACTTATATGTGCAACTGGTCACTTAAGT
TTTGCTATTCTTGTCAGGCTGTACAACTTGGAAATCGTGAGAATCTACTTTCCTTTTGCGAGGCTGTTCAGAGAAGTTCTCCTGTCAGCTCTTTTATCAG
GCCTGTTGCAGGTGCAACTGCTGGCTATGCATCTGAGGTATGACCAGTTCATCGGGAATTAGTTTTGCTGTACTTGAAGGGAACTATTTCTTTTTTCTTG
TTAGTATTGTGTTAACAGTGTAGTGGAAATAACATTATTGAAGATGGTTAATTGTTAAAGCTATGACATAGGAAACTCTTTGTTACTATCATGCCTTAAA
GCTCATGTAAAATTTGTTGCGATCCGAAATCCAAAATGAACCAATTATTTTCTTTTTATTCCTAGAAAACCTTTCTTTAAGGTCCTCCTCCAACCGCCTT
GGAATCTTTGGAATCTACAACTTTGAGGGATTTTTGTACCTTGTGGCCAAGAAATCTAAAACAATCTTACTTTCTGTCCCGAATTTTTCTTGCCTGTAAT
ACGTGCGGTCTATTTTTCGAACACTGAGTA
>LE_HBa0140O20_T7_254805 (trimmed for quality and cloning vector)
ACCTGCAGGCATGCAAGCTTCCTGATAGCTGAAGTCATGGCGGCTAAAGGTTATAAAGTGCAGCCACTTTGCCGGATCAAGCGTCATGACACAGTGCAGG
TTTGTTCGTCACATCTTGCATTTGTCTAGGCATATACAAGTCCTTGTATTGCTTACTGTCGAAGAATGCCCATCTGTTTGAAAAAATGGTCCTAAAGTGT
ACCACCCACCATTCAATCACACTTCCTCATTCAATGAGCATCGTTACTATCTTTGTGTTTCTTCTATGAATTATATCACTATATCAAGTATATAATGGTG
CTTTCAGACGTGTGCGGGTATTTTAAAGCAGTCATTGCTGGATTTCACACTTATATGTGCAACTGGTCACTTAAGTTTTGCTATTCTTGTCAGGCTGTAC
AACTTGGAAATCGTGAGAATCTACTTTCCTTTTGCGAGGCTGTTCAGAGAAGTTCTCCTGTCAGCTCTTTTATCAGGCCTGTTGCAGGTGCAACTGCTGG
CTATGCATCTGAGGTATGACCAGTTCATCGGGAATTAGTTTTGCTGTACTTGAAGGGAACTATTTCTTTTTTCTTGTTAGTATTGTGTTAACAGTGTAGT
GGAAATAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.971514
Expected error %
0.136324
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0140O20
Clone
Clone name
hba-140o20
LE_HBa0140O20
C07HBa0140O20
P140O20
Clone type
BAC
Contamination
none
Estimated length
107,096
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found