Clone Read LE_HBa0159C06_T7_254930

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0159C06_T7_254930
Primer
T7
ID from Seq. Facility
LE_HBa_159_C06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
653 trimmed for vector and quality, 873 raw
Genbank Accession
Sequence
>LE_HBa0159C06_T7_254930 (raw untrimmed)
NTTGAGGACGGGGATCTCTGAGTCGACCTGCAGGCATGCAGCTTCAGGTAGATTGTTGGCTTCTTTTAGTCACTGTGATTTCATTTGTTTGCGGATTGCT
AGTTAGAGAATGTTCTAGTTTCTTTACTTCTTATTTGCCTCAGGTCTTACTTTCATGAGCAGAGATCTTATTACACTTGTGACTAATAACCTAAGCCGCT
ATATGTGTTACATATTATATTAATCAGGAAGTTCATTCGGAAAGGTGTACTGGTATCTTTTTGTTGGTTGTAGTGCCTAATTCTTGCAATAAAGGAAGCC
TTTTCCTTCCCTTATCTTAGGGCGTTTGGGGCTGGAGTCAATCATGATATGACGTCATTCAGTTATTAGTATAATTCAATTTAGGCTCCATTAGTGCTAA
TTCAGTTGCTGGATTTGGGATCTGACAGGCTAGAAGGTTGTTGGCCAAATTAGACATCTATCGCAAGTTCACAAATGCATTGGCTGTCACTGTTGTTGTA
TCTGTTGGATGGATGTGCTATGAGGTAATTTTCAATTCCTACATGATGTGGCTGGTTCTTCATTTTAGTAACTTCTGACAAGTATCTTTGTTGCCTGTTT
GAAGAATCTGAGTTAATAAAGGGAAGTGGTTATAAGGACCTTATTGTCGACTGGTCTGCTTGATGTGACATGATTACCTTTACAGAATGACTTAACACCC
AAAAAATGAACATATATAATCCACCAAATTTGGCCTGCAATCCAATTTTCTGGAGAGAGGACTTAAATTTCCAATTATACCGGAAGCAGAAAGCATAATT
AGGCCCTTTTAAAGGTTTGCCAATCATTCGGTAATCTTTTCCATAGTTCAGGGCCCTTTAAGGGGTCAAAAGC
>LE_HBa0159C06_T7_254930 (trimmed for quality and cloning vector)
GTCGACCTGCAGGCATGCAGCTTCAGGTAGATTGTTGGCTTCTTTTAGTCACTGTGATTTCATTTGTTTGCGGATTGCTAGTTAGAGAATGTTCTAGTTT
CTTTACTTCTTATTTGCCTCAGGTCTTACTTTCATGAGCAGAGATCTTATTACACTTGTGACTAATAACCTAAGCCGCTATATGTGTTACATATTATATT
AATCAGGAAGTTCATTCGGAAAGGTGTACTGGTATCTTTTTGTTGGTTGTAGTGCCTAATTCTTGCAATAAAGGAAGCCTTTTCCTTCCCTTATCTTAGG
GCGTTTGGGGCTGGAGTCAATCATGATATGACGTCATTCAGTTATTAGTATAATTCAATTTAGGCTCCATTAGTGCTAATTCAGTTGCTGGATTTGGGAT
CTGACAGGCTAGAAGGTTGTTGGCCAAATTAGACATCTATCGCAAGTTCACAAATGCATTGGCTGTCACTGTTGTTGTATCTGTTGGATGGATGTGCTAT
GAGGTAATTTTCAATTCCTACATGATGTGGCTGGTTCTTCATTTTAGTAACTTCTGACAAGTATCTTTGTTGCCTGTTTGAAGAATCTGAGTTAATAAAG
GGAAGTGGTTATAAGGACCTTATTGTCGACTGGTCTGCTTGATGTGACATGAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.959489
Expected error %
0.0871662
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g72480.1 Score 64 E Value 9e-11 Identity 24.60% Align. Length 113bp (17.30%) Frame 1
68414.m08381 expressed protein
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0159C06
Clone
Clone name
hba-159c6
LE_HBa0159C06
C03HBa0159C06
P159C06
Clone type
BAC
Contamination
none
Estimated length
104,190
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found