Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0159I07_T7_255167

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0159I07_T7_255167
Primer
T7
ID from Seq. Facility
LE_HBa_159_I07-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
672 trimmed for vector and quality, 906 raw
Genbank Accession
Sequence
>LE_HBa0159I07_T7_255167 (raw untrimmed)
NTTGTGGACGGGGATCTCTGAGTCGACCTGCAGGCATGCAAGCTTGTTATTGACTTTTGAATAATTTTAAATATTATTGTTGGCGCATGACATAATTAAT
GTAGCGATTGTATAATCATTTCCAAACTACTTACTGTACTATAGTCGGGAACTTAGTAATGTGGATCCTCGTGTCATGGGGCATAACCTCGACATTTTTG
ATTGAGTATGATGAAATAAGATATTTATCGAGATAATAATAACAAATATTTTTACGATCCATCTTCTAACTTGTTATTTTCAACAAATCAATAGCTAACA
ATCATATATATATATATATATATATATATATATATATGAAAATCTTAGGTTCGTCTACATGGCGTTCCAACAAACAAAAGTTTTATTTAATATTTATTTA
TTTTTTAAACTAGCCTTTCTCTTTTCACGGAAACTTGAGACTTTTATGAAGAGTTGTGACTTTTATGTAAAATTGTGACTTTTATTAAAAATTGTGACTT
TTATGAAGAGTTACGACTTTAATGAAGAATTGCAACTTTCATGAAAAGTTGCGATTTTAATAAAGAGTTGCAACTTTTATGAAAAGTTGTAACTTTATGA
AAGGTTGTGACCTATACGAAGAGTTGTAATTTTTCCAAATAGTTGTAACCTCGCAACAAACATTTGTGCAAGTCACCCTTTGTTGTCTCTTATTTTAAAA
CATTGAAAATTTCAAACCTTTCTTCTTCTTTTTTTTTTCTAACTAAATATTTGTGTACTTCGTTCCTGTTGAATGACTCCCTAACACCATTACTTATTGT
ACCGATTCTTATATGTATTTTTATTCCCATTAATTTTTTCCCAGGTTATTAAGAAAAATGATAGAAAAGTTACCTTTATCCCCAAATAATTCGGTCATGG
GTTCGG
>LE_HBa0159I07_T7_255167 (trimmed for quality and cloning vector)
GTCGACCTGCAGGCATGCAAGCTTGTTATTGACTTTTGAATAATTTTAAATATTATTGTTGGCGCATGACATAATTAATGTAGCGATTGTATAATCATTT
CCAAACTACTTACTGTACTATAGTCGGGAACTTAGTAATGTGGATCCTCGTGTCATGGGGCATAACCTCGACATTTTTGATTGAGTATGATGAAATAAGA
TATTTATCGAGATAATAATAACAAATATTTTTACGATCCATCTTCTAACTTGTTATTTTCAACAAATCAATAGCTAACAATCATATATATATATATATAT
ATATATATATATATATGAAAATCTTAGGTTCGTCTACATGGCGTTCCAACAAACAAAAGTTTTATTTAATATTTATTTATTTTTTAAACTAGCCTTTCTC
TTTTCACGGAAACTTGAGACTTTTATGAAGAGTTGTGACTTTTATGTAAAATTGTGACTTTTATTAAAAATTGTGACTTTTATGAAGAGTTACGACTTTA
ATGAAGAATTGCAACTTTCATGAAAAGTTGCGATTTTAATAAAGAGTTGCAACTTTTATGAAAAGTTGTAACTTTATGAAAGGTTGTGACCTATACGAAG
AGTTGTAATTTTTCCAAATAGTTGTAACCTCGCAACAAACATTTGTGCAAGTCACCCTTTGTTGTCTCTTAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.9251
Expected error %
0.0464744
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0159I07
Clone
Clone name
hba-159i7
LE_HBa0159I07
C02HBa0159I07
P159I07
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found