Clone Read LE_HBa0089M01_SP6_25536

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0089M01_SP6_25536
Primer
SP6
ID from Seq. Facility
LE_HBa_089_M01-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
22 trimmed for vector and quality, 808 raw
Sequence
>LE_HBa0089M01_SP6_25536 (raw untrimmed)
GGGGGGAGGAAGATAGGTGGTAATAAGCTTGTGGGGTGGGACTGCTACAATGTTCAAGAGTTGGCCCGAGGAAAGAAGCTCCTCAAGGGGGCGACAACGA
AAGCNGCGGGNGACCCAGCGCTTAAGGGGGGACCANNCCACGGGGGACAGACGCAACGGCCNNAACGGCAGCGAGAAGCAGAAGAGCAACGAGGCGAAAA
GGA
GAAGGAACGGGAGCAGAGAAGGCNNNAAGGGAAGGGGGGGGGGAGCGAANGCGGANAGNGGGGAAGCGCAAGAAGAAGGAAGGAAGACGGGCGCCAA
GAAGGGAACCGAGACGGAGAGNAGAAGAAGAAGAAGAAGAAGGAGAGCGAGGNGAGAGGAGGGAGAACGAAGCCAAGGCGGGAGAAGAAACCAACGCCAC
GGAACCCACCGAGACACCCAAGCACCAGGCGGACACAGACGAGAACGCGAGAGAGGGGCCGCGAGGGAAGCACGCGCCGCACAGCCGCCCGCGGACCNAC
AGCGACGGCGCACGGGCCCGAGGGGGGGGACCGCGCAGAGAGGGGGGGGCGGCGAAACGGCGACGCGCAGAGAGGCACAGGGGCGGAACGAAACGACCCC
CCCCAACACCACAAGCGACCCAAACGGACACACACAGCGCACGAACGCCACAACCCCCAACAACCAAGCAGGAACCCGGGCCGACACCCGAGCGGCGCAC
GAGGAGCGAACGAAGAACGGCAAGGGAACGCAAAACAGAAACAAAACAGGACGAGGGAAGGGACACAGAGAGCGCAAGCAACCCCCCCGGGCGAGGACCG
CGCACACA
>LE_HBa0089M01_SP6_25536 (trimmed for quality and cloning vector)
GAAGGAACGGGAGCAGAGAAGG

This is probably not a useful sequence.

Problems:
  • Short cloning insert
  • Low complexity
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
2.47929
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0089M01
Clone
Clone name
hba-89m1
LE_HBa0089M01
C01HBa0089M01
P089M01
Clone type
BAC
Contamination
none
Estimated length
83,284
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found