Clone Read LE_HBa0089M01_T7_25537

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0089M01_T7_25537
Primer
T7
ID from Seq. Facility
LE_HBa_089_M01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
643 trimmed for vector and quality, 860 raw
Genbank Accession
Sequence
>LE_HBa0089M01_T7_25537 (raw untrimmed)
CCTCACGGGGTCCCGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCAACCTTTAGGATGAGGGTTCTTTTTCCATAAATAATAAAACATATAG
ATAAACATAATTTTGTTAGTGACCTGACATCTTAGATGAAGATCTCTAGAAGTTACAATCATCAGGCTAAGATGCACGTTTTCAATTGGATTGTGGGAAT
CAGACTGCCTTTTGATTGTGAGATAAGTTTGATACTTCATTCGGGATTTTCGATTGTGTATATTATTACTAATAAGCTCTTACCGAAGTAGATAAAAAAC
ATCATGAAAATCAATGCAAATCATGGGAAAGTTATGGTGAGCTATGTTGGTGGTGGACAGAGTGTAGGAGCAGTCAGTATTTTCGAAGGAAAATCTTGGT
GCACATCTTACTGTTTGGCTTCAGAAATTCCCGTAATTCTAGCGGGAGTTTGTTGATAGAATTTCTTGTCTGGTGAAATGTTTGCAGACATAAATACATG
GAAAACCACATTATTGAATACTGATAGACATCTTACTTGTCCTCCTAGGGAGAAGGGCTCAACTTGAGAAAAAGCAGGTCTTAACAAAAATGATGAGGCT
TGGGAGAAAGGCATGCCCTGCCTCTGTGACTAACTAGGAGTGAAAAACACCCATGTATCCATATATGGTGGATAGGGCCTGTTCCTTTTGTATGAATTCT
TGCTGAGATGGAAGAGTTTTTGTGATTATCAGAAGTTGAAAGGAAGTTTACTTAAATCTATTTTCAGAAGAATAGCTTATGGCGGTGGTGAAAATTTGGA
AAGATATTGAGATATAATTTCCTAATGGCGCAGATCTGCTTTCTCGAAGGGTCCCTAGTG
>LE_HBa0089M01_T7_25537 (trimmed for quality and cloning vector)
AGCTTCAACCTTTAGGATGAGGGTTCTTTTTCCATAAATAATAAAACATATAGATAAACATAATTTTGTTAGTGACCTGACATCTTAGATGAAGATCTCT
AGAAGTTACAATCATCAGGCTAAGATGCACGTTTTCAATTGGATTGTGGGAATCAGACTGCCTTTTGATTGTGAGATAAGTTTGATACTTCATTCGGGAT
TTTCGATTGTGTATATTATTACTAATAAGCTCTTACCGAAGTAGATAAAAAACATCATGAAAATCAATGCAAATCATGGGAAAGTTATGGTGAGCTATGT
TGGTGGTGGACAGAGTGTAGGAGCAGTCAGTATTTTCGAAGGAAAATCTTGGTGCACATCTTACTGTTTGGCTTCAGAAATTCCCGTAATTCTAGCGGGA
GTTTGTTGATAGAATTTCTTGTCTGGTGAAATGTTTGCAGACATAAATACATGGAAAACCACATTATTGAATACTGATAGACATCTTACTTGTCCTCCTA
GGGAGAAGGGCTCAACTTGAGAAAAAGCAGGTCTTAACAAAAATGATGAGGCTTGGGAGAAAGGCATGCCCTGCCTCTGTGACTAACTAGGAGTGAAAAA
CACCCATGTATCCATATATGGTGGATAGGGCCTGTTCCTTTTG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.966
Expected error %
0.426559
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0089M01
Clone
Clone name
hba-89m1
LE_HBa0089M01
C01HBa0089M01
P089M01
Clone type
BAC
Contamination
none
Estimated length
83,284
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found