Clone Read LE_HBa0165B12_T7_255533

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0165B12_T7_255533
Primer
T7
ID from Seq. Facility
LE_HBa_165_B12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
589 trimmed for vector and quality, 944 raw
Sequence
>LE_HBa0165B12_T7_255533 (raw untrimmed)
TGATGTCGGGGACTCTGAGTCACCTGCAGGCATGCAAGCTTCCAATTAAATGTCATGGCCATTTTTCGCGACTCCTACCTTTGTAGTAATACTAATATGT
GTGTGTTTTGAATGTTGATGAAATGCTTAGAGGGAGCAAGGAATTTATATAGTACTTCAGGTGTTGTTAATGTTGACATTTTCTCATGGTAATTGAGTTC
CCTGGAATGCCCGGTATGCTATGTGTGATTGTGACAATAGAGATAGATCCCGTACATGCTACTCTGTTGTCTTTAAATTATATATCCTAATGAGCACCTC
ATTTGTAGCTTTATGATGTGTTTTCTTCCCATAATCTTAGCAATGGAGTACATGAACATAATGTTGTCCTGAATGCAAAATACAATCGCTTCTTTATTGG
CAATTTACGTGACATGGACCATGACAAGGGATATTACTATACTGAAAATGGAAGTCGAAGGTTAAATAATAAAGGGGAAGAAAGCAAATCTCAGCAATGA
AAGAATATTGACTGCAATATTGAATGAAGGGGTTCTCATCACTTTCTTTTGTAAAATTCCTAGTGTTCGAGTGAGAGAACATGTAGGAAATCCATATCGT
TGGTAGTGAACGAGTAGAAAAATATCATTGTAGTCGTTGGTGTGACCCTGCTTAAAACCATACTCTTTTGATTCTGTGAAAGTCACTCGTTGAAACATAA
CCACAGGTAAATAATTGTCTTATCACTCAATTCCTCTCTAATCTCACAGTATTTCTACATTTGACCCCTTTATTTCTGGTCTTTCATTACCTTACCTTCC
TCTTTACACTTACCTCTTATATTCACATGTTTTTTCTCAACTTTTCTACATACATCCTTGATGAGCTTTTTTTTACTTCTATCTATTTTCTTCTTAATTA
ACTCACTATCTCTCTCAATACTCCGTCATTTTTTTCCTTTCCAT
>LE_HBa0165B12_T7_255533 (trimmed for quality and cloning vector)
GCAGGCATGCAAGCTTCCAATTAAATGTCATGGCCATTTTTCGCGACTCCTACCTTTGTAGTAATACTAATATGTGTGTGTTTTGAATGTTGATGAAATG
CTTAGAGGGAGCAAGGAATTTATATAGTACTTCAGGTGTTGTTAATGTTGACATTTTCTCATGGTAATTGAGTTCCCTGGAATGCCCGGTATGCTATGTG
TGATTGTGACAATAGAGATAGATCCCGTACATGCTACTCTGTTGTCTTTAAATTATATATCCTAATGAGCACCTCATTTGTAGCTTTATGATGTGTTTTC
TTCCCATAATCTTAGCAATGGAGTACATGAACATAATGTTGTCCTGAATGCAAAATACAATCGCTTCTTTATTGGCAATTTACGTGACATGGACCATGAC
AAGGGATATTACTATACTGAAAATGGAAGTCGAAGGTTAAATAATAAAGGGGAAGAAAGCAAATCTCAGCAATGAAAGAATATTGACTGCAATATTGAAT
GAAGGGGTTCTCATCACTTTCTTTTGTAAAATTCCTAGTGTTCGAGTGAGAGAACATGTAGGAAATCCATATCGTTGGTAGTGAACGAG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.952602
Expected error %
0.164661
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0165B12
Clone
Clone name
hba-165b12
LE_HBa0165B12
C12HBa0165B12
P165B12
Clone type
BAC
Contamination
none
Estimated length
79,320
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found