Clone Read LE_HBa0165F11_T7_255673

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0165F11_T7_255673
Primer
T7
ID from Seq. Facility
LE_HBa_165_F11-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
661 trimmed for vector and quality, 969 raw
Sequence
>LE_HBa0165F11_T7_255673 (raw untrimmed)
NNNNCCCCNNNNCCGCTGACGGGGATCTCTGAGTGACCTGCAGCATGCAAGCTTTTCAACAGATAAAAAATTACACATGCAACTTGCACCTTAAGAATTT
CAATTCGTCCAATTAGACCAGGTTTTGGGATGTATATCTTCCGATCAAACCGCCCTGGTCGAACAAGTGCTGGGTCCAATATGTCTGGTCTATTTGTAGA
AGCAATAGTGATGACTTCACCTTTGCCTTCAAAACCATCCAAGCATACAAGAAGCTGGAGAAAAAAGGGGAACATTCTAAATTAATGTAGCCTGAGATCT
CCACAAGATGAAGTGACAGTTCACACAAGAGCAAAATGCCAAGGGAACCTGATTCAAAGTCGCATCACGTTCTTGTCCACCTGAACCCTTGATCAAACCA
CGTTCTCTGCCAACTGCATCCAGCTCATCGATGAACACCACTGATGGGGCCTACGCAAGACCACATAATAATGCTCATATCTTGTTGAGACTTTATAAGT
TACATATAAAACCACTCTAAATAAAAGCAAAAATGGCTTGACAAGATTCAGAAACAAGAACATGAAGCAGCCCACTCAACAACAGAGAAACAAGCAATCA
ACTACTACTCAACACCAAACTAGCTGCGGTTTGCAATATTAAAAGACAAAAGCAAACAGTTCATTCAGAATAGGAAGCAAATGGCAGAATCTTAATTCAC
AGCATAGGTAGAAAAAGAGTAGCCAACTATAACGCCAAGCATTTATAAGCAAATGACTCTGACCGATAGCGTGGATAGTAGAGAGATAGAAAATAACTTA
CATTCCCCTTGCCTCCTGGTAGAGAAGCTCAACACGGGAAGCCCCAACACCACTTATATCTCAACCAACTGAGACCCAGAAATGGAAAAAAATTCCCCCC
TGGCTTACCAGCCACCGCCTTTGCTAACAAATCTTCCCCCTCCCGGTGGGACACAAAACATATTTCCCC
>LE_HBa0165F11_T7_255673 (trimmed for quality and cloning vector)
GCATGCAAGCTTTTCAACAGATAAAAAATTACACATGCAACTTGCACCTTAAGAATTTCAATTCGTCCAATTAGACCAGGTTTTGGGATGTATATCTTCC
GATCAAACCGCCCTGGTCGAACAAGTGCTGGGTCCAATATGTCTGGTCTATTTGTAGAAGCAATAGTGATGACTTCACCTTTGCCTTCAAAACCATCCAA
GCATACAAGAAGCTGGAGAAAAAAGGGGAACATTCTAAATTAATGTAGCCTGAGATCTCCACAAGATGAAGTGACAGTTCACACAAGAGCAAAATGCCAA
GGGAACCTGATTCAAAGTCGCATCACGTTCTTGTCCACCTGAACCCTTGATCAAACCACGTTCTCTGCCAACTGCATCCAGCTCATCGATGAACACCACT
GATGGGGCCTACGCAAGACCACATAATAATGCTCATATCTTGTTGAGACTTTATAAGTTACATATAAAACCACTCTAAATAAAAGCAAAAATGGCTTGAC
AAGATTCAGAAACAAGAACATGAAGCAGCCCACTCAACAACAGAGAAACAAGCAATCAACTACTACTCAACACCAAACTAGCTGCGGTTTGCAATATTAA
AAGACAAAAGCAAACAGTTCATTCAGAATAGGAAGCAAATGGCAGAATCTTAATTCACAGC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.958112
Expected error %
0.102981
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g16290.1 Score 107 E Value 9e-39 Identity 91.20% Align. Length 363bp (54.92%) Frame 1
68416.m02056 FtsH protease, putative contains similarity to cell division protein FtsH GI:1652085 from [Synechocystis sp. PCC 6803]
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g42270.1 Score 75 E Value 1e-22 Identity 57.90% Align. Length 363bp (54.92%) Frame 1
68418.m05145 FtsH protease, putative similar to FtsH protease GI:13183728 from [Medicago sativa]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAB63647.1| Score 107 E Value 4e-37 Identity 91.20% Align. Length 363bp (54.92%) Frame 1
cell division protein FtsH isolog [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAB01269.1| Score 107 E Value 4e-37 Identity 91.20% Align. Length 363bp (54.92%) Frame 1
cell division protein FtsH-like [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0165F11
Clone
Clone name
hba-165f11
LE_HBa0165F11
C03HBa0165F11
P165F11
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found