Clone Read LE_HBa0165K18_T7_255873

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0165K18_T7_255873
Primer
T7
ID from Seq. Facility
LE_HBa_165_K18-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
630 trimmed for vector and quality, 965 raw
Sequence
>LE_HBa0165K18_T7_255873 (raw untrimmed)
TTTATCCNNNNCCGCGGACGGGGATCTCTGAGTGACCTGCAGGCATGCAAGCTTAACGCTCCAATCCATATCATGGCTCCAATGGTATTACTGTTGGCAA
CGGTGAGTCCTTTAATATTTCTTACACTGGCACGGGTACCATTAAAACCCCCACCGCTATCTTTCACCTAGGTAACCTTACCCACGTCCCTTCTATTAAA
GCTAATCTCCTTTCAGTTCACCAATTCACAAAAGACAATAATTGCTCACTCTTGTTCACCTCTAATGATTTTCTGATCCTAGACAATACTACCAAGAGGG
TGATTTTTTAGGGCCCTTGTGAGCATGGTCTGTACGTTCTTCCTAGCACAAGTTCATCTGCCCACCCAGTTTCAGAAAGCGTTCCTGTGGCTCCAGTGGC
TCTTTCGGCTGATGGCCACAGTCTGTTGTGGCACAGTCGTCTGGGTCACCCCTCTACTCAAATAATAAATTCTTTAATGTCTCAATTAGGTTTTTCTTCC
ATTCATGTAAACAATTGTGACTCCTGTTCAATTGCTAAATCTCATAAATTACCTTTTACTTCATCTGAGAAGCGTACAACTGCACCTTTTCAACTTATTC
ATTCTGACCTATGGGGTCCTACTGCTATTCCTTCATTTGCTGGTTTTCGCTATTATATTTGTTTTGTGGATGATTTTACAAAATACACTTGGTTGTACCC
CACTAAACACAAATCACCAGCATACACCACCTTTGTCACCTTTGAAAAAACTGGTCAAAACACATTTCAATTCCCCATGTTAAACTTTTTCCAAATGAAC
AATGGAAAGGAATATGTAAATAACCATCTTTGGCCCGTTTCCTGCATCCCTGGGGAATTATACATTAAAACTCCCGGTCCATACCTTCCCCAAACAAAAA
GTGGGTGGCTTAACTTAAGTCCCTCTCCCTCTTCTTGAAACCGGGGGTTTTCTTTCCCTATTAAA
>LE_HBa0165K18_T7_255873 (trimmed for quality and cloning vector)
AGGCATGCAAGCTTAACGCTCCAATCCATATCATGGCTCCAATGGTATTACTGTTGGCAACGGTGAGTCCTTTAATATTTCTTACACTGGCACGGGTACC
ATTAAAACCCCCACCGCTATCTTTCACCTAGGTAACCTTACCCACGTCCCTTCTATTAAAGCTAATCTCCTTTCAGTTCACCAATTCACAAAAGACAATA
ATTGCTCACTCTTGTTCACCTCTAATGATTTTCTGATCCTAGACAATACTACCAAGAGGGTGATTTTTTAGGGCCCTTGTGAGCATGGTCTGTACGTTCT
TCCTAGCACAAGTTCATCTGCCCACCCAGTTTCAGAAAGCGTTCCTGTGGCTCCAGTGGCTCTTTCGGCTGATGGCCACAGTCTGTTGTGGCACAGTCGT
CTGGGTCACCCCTCTACTCAAATAATAAATTCTTTAATGTCTCAATTAGGTTTTTCTTCCATTCATGTAAACAATTGTGACTCCTGTTCAATTGCTAAAT
CTCATAAATTACCTTTTACTTCATCTGAGAAGCGTACAACTGCACCTTTTCAACTTATTCATTCTGACCTATGGGGTCCTACTGCTATTCCTTCATTTGC
TGGTTTTCGCTATTATATTTGTTTTGTGGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.967995
Expected error %
0.0984983
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
pir||T02087 Score 130 E Value 3e-29 Identity 12.30% Align. Length 599bp (95.08%) Frame 3
gag/pol polyprotein - maize retrotransposon Hopscotch gb|AAA57005.1| copia-like retrotransposon Hopscotch polyprotein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_476197.1| Score 129 E Value 4e-29 Identity 12.20% Align. Length 599bp (95.08%) Frame 3
putative polyprotein [Oryza sativa (japonica cultivar-group)] gb|AAT07631.1| putative polyprotein [Oryza sativa (japonica cultivar-group)] gb|AAT07563.1| putative polyprotein [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0165K18
Clone
Clone name
hba-165k18
LE_HBa0165K18
P165K18
Clone type
BAC
Contamination
none
Estimated length
81,193
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found