Clone Read LE_HBa0185A15_T7_257694

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0185A15_T7_257694
Primer
T7
ID from Seq. Facility
LE_HBa_185_A15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
553 trimmed for vector and quality, 964 raw
Sequence
>LE_HBa0185A15_T7_257694 (raw untrimmed)
NNCCCTATGTCGGGGATCTCTGAGTCGACCTGCAGGCATGCAAGCTTCCTTTCAGATTTGATTAAAAAGAAGGTCTTAAACAATTTATTAAAGTAGCACA
ACCCTTGTTTCCACATTCCTTCCCGTACCACTATGAATCGTGACTGTTTTGATCTTTTTTATGAAGAAAAACATAAGTTGATGGCTGTTTTTAAGGAAAT
ACAACAAAGGGTGTCTTTAACCACTGATACTTGGACTTCCATACAAAGAATCAATTATATGGTCATTACTGCTCATTAGATTGATAAAAATTGGACTTTG
CACAAAAGAGTTATCAACTTTTGTCCAATCACTAGTCATAGAGGTGAAGATCTTGAAAAGTCTATTAGTAAGCGCTTACGTGAGTGGGGATTGCATCGAA
TTTTCAGTGTAACAGTTGATAATGCTGGTTCAAATAGTGTGGCAATAACTGAGTTGTCTAAGTAATTAATTAAATGGGGACCAACTTAATGGGTGATAGT
CAGCTTCATATAAGGTATATGGCTCATATTGTAAATCTTATTGTTCAAGATGGTATAAAAGAAGCAAATGTGTCTATTGAACGAGATAGGCAAGCCGTGA
GATACATCAGGCAATCTCCNCCTAGGTGGATAAATTTCAAGAATGTCGTGAAGATGAAATCTTGCTAAATAGTCTTTATGCTTGGATGTCCCTCCAAGTC
GGAATTCCACCTACGTGATGTTGACCAGGTTTATTGAATTTAAAGGGGCCATTGTAAGAGTACCCCGATCGTGATATTTGACTTGGGCCTTAATCCTTAA
ATTGGTTAGATACCTCGNCCNTCTGGTACCCTTTTTACAAAATTGAATTGTGAGGGCTTAAAACAGAAATTACCAAATTTTTTTGAAAGGTTTTTAATCT
CTCCTTTTAAAAAAATTTGGCGTCTCCACCCTGTGTAACTCCAAATCCTCTCCTTTTCCTGAGA
>LE_HBa0185A15_T7_257694 (trimmed for quality and cloning vector)
CAGGCATGCAAGCTTCCTTTCAGATTTGATTAAAAAGAAGGTCTTAAACAATTTATTAAAGTAGCACAACCCTTGTTTCCACATTCCTTCCCGTACCACT
ATGAATCGTGACTGTTTTGATCTTTTTTATGAAGAAAAACATAAGTTGATGGCTGTTTTTAAGGAAATACAACAAAGGGTGTCTTTAACCACTGATACTT
GGACTTCCATACAAAGAATCAATTATATGGTCATTACTGCTCATTAGATTGATAAAAATTGGACTTTGCACAAAAGAGTTATCAACTTTTGTCCAATCAC
TAGTCATAGAGGTGAAGATCTTGAAAAGTCTATTAGTAAGCGCTTACGTGAGTGGGGATTGCATCGAATTTTCAGTGTAACAGTTGATAATGCTGGTTCA
AATAGTGTGGCAATAACTGAGTTGTCTAAGTAATTAATTAAATGGGGACCAACTTAATGGGTGATAGTCAGCTTCATATAAGGTATATGGCTCATATTGT
AAATCTTATTGTTCAAGATGGTATAAAAGAAGCAAATGTGTCTATTGAACGAG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.951493
Expected error %
0.382199
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAP51893.1| Score 118 E Value 7e-31 Identity 47.80% Align. Length 481bp (86.98%) Frame 3
putative Tam3-like transposon protein [Oryza sativa (japonica cultivar-group)] ref|NP_919606.1| putative Tam3-like transposon protein [Oryza sativa (japonica cultivar-group)] gb|AAL31650.1| Putative Tam3-like transposon protein [Oryza sativa]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB82966.1| Score 118 E Value 1e-28 Identity 45.00% Align. Length 475bp (85.90%) Frame 3
putative protein [Arabidopsis thaliana] pir||T48044 hypothetical protein T12C14.220 - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0185A15
Clone
Clone name
hba-185a15
LE_HBa0185A15
P185A15
Clone type
BAC
Contamination
none
Estimated length
97,119
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found