Clone Read LE_HBa0185M07_T7_257955

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0185M07_T7_257955
Primer
T7
ID from Seq. Facility
LE_HBa_185_M07-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
565 trimmed for vector and quality, 986 raw
Sequence
>LE_HBa0185M07_T7_257955 (raw untrimmed)
TTTGGCGCTGACGGGGATCTCTGAGTCGACCTGCGGCATGCAGCTTCACAAGGTGTTCAAAAAAGAAAAAAGTTGTTGTTGAAGAACCCAAATATGATTC
GTATTCTGATACGATGGATGAAATAGACAACTATGAGGAGAGTTTTGATGAGGTTGAGTCTAGTGAAGAGAGCAGTGGAGACGAGTCCACTAGTGAAGAT
AGCCGAGATACTGGAGATGAGGATAATGATCCTCTATCCTGGCCAACTTGTGCAAGAGAAATCTCGGATAAGTCCTATAATCTCACTACGTGTATGGATG
AGTTAGGATCTTTTCCATTCAAGATTTCTGTGAGAGCAAGAATGACTTTGTATAATGATTTTAGAAATGTTTTACTTAATGAAAAAAATTATAATGACTT
TAAAGGTAGTTGTTTTGGTCATGTAAGGCATATTTCAGAATTTTACAAGTTTAATGGACAAATGGTTCATTACATGTTGTTGTTCGTGTCAATCGTGATA
AAAGTTGCATGAAATATAATTTTGTGTGAATGATAAGGCTTCATGTTTTGGGCTTAAAAGTGTTTGCATTGATTATGGTCTGAATTGTGGAGCGTACTCC
GCGATATAAAAATATAAAAATTGTTTGACATAGGTGAGNAATTTTACTATGAAGTAATCAAGAATAAGAATATTAGTGGGTCGAAGTTGTTGAGTTTGAT
TAAGGGTTCAAATTGAATAAAGAGTAGAAGTTCAAGTGCTCCTTAGTTTGGTTCGTCTACTCCATATTACTTTGCCCACGATCAATCTAAAGATGTAAAA
TCCAACCCCTTTTTAAGATGACCCAGGGTTCCNNAGCTTTTTCAGGAGCTTTTTTTTGGGGAAAAGAAAGGCTTTGATTTTGACACCTTTAGTATTTTGA
AAAACCAAAATTATTTTTAAAAAAACAATTGTGATTTGTTCCAAGGAAAAAACCTCCTTATTGCTTTGTAAGACTTTTTCCCTGGG
>LE_HBa0185M07_T7_257955 (trimmed for quality and cloning vector)
AGCTTCACAAGGTGTTCAAAAAAGAAAAAAGTTGTTGTTGAAGAACCCAAATATGATTCGTATTCTGATACGATGGATGAAATAGACAACTATGAGGAGA
GTTTTGATGAGGTTGAGTCTAGTGAAGAGAGCAGTGGAGACGAGTCCACTAGTGAAGATAGCCGAGATACTGGAGATGAGGATAATGATCCTCTATCCTG
GCCAACTTGTGCAAGAGAAATCTCGGATAAGTCCTATAATCTCACTACGTGTATGGATGAGTTAGGATCTTTTCCATTCAAGATTTCTGTGAGAGCAAGA
ATGACTTTGTATAATGATTTTAGAAATGTTTTACTTAATGAAAAAAATTATAATGACTTTAAAGGTAGTTGTTTTGGTCATGTAAGGCATATTTCAGAAT
TTTACAAGTTTAATGGACAAATGGTTCATTACATGTTGTTGTTCGTGTCAATCGTGATAAAAGTTGCATGAAATATAATTTTGTGTGAATGATAAGGCTT
CATGTTTTGGGCTTAAAAGTGTTTGCATTGATTATGGTCTGAATTGTGGAGCGTACTCCGCGATA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.942245
Expected error %
0.0834143
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0185M07
Clone
Clone name
hba-185m7
LE_HBa0185M07
C08HBa0185M07
P185M07
Clone type
BAC
Contamination
none
Estimated length
142,410
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found