Clone Read LE_HBa0045J15_SP6_258307

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0045J15_SP6_258307
Primer
SP6
ID from Seq. Facility
LE_HBa_045_J15-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
759 trimmed for vector and quality, 883 raw
Genbank Accession
Sequence
>LE_HBa0045J15_SP6_258307 (raw untrimmed)
NNNNNGGCTATANATTCTGATTTCCTTATCATCATGGTTGTTATAGATTCATTATGCTAAATTGCTGACTCACACCAGAAGATGATCTAGTCATGTGATA
GAGACAGGGATACTCCTAAAAGTCTTTGTTCATTCAATGGTAGCTGCAGGCATATTTACACAGTAGTTTATTACATACTTATTCCAGGAAACTGAACTAC
CATATTCACTTCATATTCAAATGCATGCATCAGTATACCAACCTAACCTGGAAATTTGCTTCTCCTGTAGAATTCTGAAGATGATGCATACAATTTCTTC
ACATGCATCTGAAAATCGGATGACTCCATCTGCTGTTGCTGCTTGTATGGCACCATTGCTTTTACGCCCTCTTTTAGCGGGGGAATGTGAGTTGGAGGAT
GACTTTGATGTTAGTGGAGACAACTCTGCTCAGCTTCTTGCCGCCGCTAATGCAGCCAATAATGCCCAGGCTATCATTACGACACTTCTTGAGGAGTATG
AGAATATTTTTGATGTAAGTAGCTCCAAAATAAAAGACAAAAGTGTGTTCACCAAAAACTAAAAACAGTGAAGTTGTTTAAGAGTTTGTCTATTCTCTTT
TGTGGCTTGATTTCTTTGTCCTTTCTCCTTAATTATGTGTTTATTTTCCATTTTCCCTTTATTTATGGGTTCTGTATCGTTATCCCATGTGATTCTCTTT
CATCTCTCTTTACATTTGCTTTCTGTTTATCGGTTCTGGATTTCATCTTTCAAATGAAAGTATTTTCTCTTTATCGACTTACTTGGTCTATCTTACTATA
GTGCATATTTGTTGTACTANGTATGTCCTTGTGCAGAATTTCGTTTGACGGTTGAGCTTAGCTATTTGTTACCTTTGCCTGCA
>LE_HBa0045J15_SP6_258307 (trimmed for quality and cloning vector)
TATCATCATGGTTGTTATAGATTCATTATGCTAAATTGCTGACTCACACCAGAAGATGATCTAGTCATGTGATAGAGACAGGGATACTCCTAAAAGTCTT
TGTTCATTCAATGGTAGCTGCAGGCATATTTACACAGTAGTTTATTACATACTTATTCCAGGAAACTGAACTACCATATTCACTTCATATTCAAATGCAT
GCATCAGTATACCAACCTAACCTGGAAATTTGCTTCTCCTGTAGAATTCTGAAGATGATGCATACAATTTCTTCACATGCATCTGAAAATCGGATGACTC
CATCTGCTGTTGCTGCTTGTATGGCACCATTGCTTTTACGCCCTCTTTTAGCGGGGGAATGTGAGTTGGAGGATGACTTTGATGTTAGTGGAGACAACTC
TGCTCAGCTTCTTGCCGCCGCTAATGCAGCCAATAATGCCCAGGCTATCATTACGACACTTCTTGAGGAGTATGAGAATATTTTTGATGTAAGTAGCTCC
AAAATAAAAGACAAAAGTGTGTTCACCAAAAACTAAAAACAGTGAAGTTGTTTAAGAGTTTGTCTATTCTCTTTTGTGGCTTGATTTCTTTGTCCTTTCT
CCTTAATTATGTGTTTATTTTCCATTTTCCCTTTATTTATGGGTTCTGTATCGTTATCCCATGTGATTCTCTTTCATCTCTCTTTACATTTGCTTTCTGT
TTATCGGTTCTGGATTTCATCTTTCAAATGAAAGTATTTTCTCTTTATCGACTTACTTG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.952894
Expected error %
0.215562
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g19390.1 Score 105 E Value 4e-23 Identity 22.50% Align. Length 230bp (30.30%) Frame 1
68418.m02310 pleckstrin homology (PH) domain-containing protein / RhoGAP domain-containing protein weak similarity to rho-GTPase activating protein [Homo sapiens] GI:14245732; contains Pfam profiles PF00169: PH domain, PF00620: RhoGAP domain
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g19390.2 Score 105 E Value 4e-23 Identity 22.50% Align. Length 230bp (30.30%) Frame 1
68418.m02311 pleckstrin homology (PH) domain-containing protein / RhoGAP domain-containing protein weak similarity to rho-GTPase activating protein [Homo sapiens] GI:14245732; contains Pfam profiles PF00169: PH domain, PF00620: RhoGAP domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD31104.1| Score 108 E Value 2e-22 Identity 21.80% Align. Length 233bp (30.70%) Frame 1
pleckstrin homology (PH) domain-containing protein-like [Oryza sativa (japonica cultivar-group)] dbj|BAD30338.1| pleckstrin homology (PH) domain-containing protein-like [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD73820.1| Score 108 E Value 2e-22 Identity 21.80% Align. Length 233bp (30.70%) Frame 1
pleckstrin homology (PH) domain-containing protein-like [Oryza sativa (japonica cultivar-group)] dbj|BAD73663.1| pleckstrin homology (PH) domain-containing protein-like [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0045J15
Clone
Clone name
hba-45j15
LE_HBa0045J15
P045J15
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found