Clone Read LE_HBa0195O08_T7_258416

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0195O08_T7_258416
Primer
T7
ID from Seq. Facility
LE_HBa_195_O08-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
502 trimmed for vector and quality, 970 raw
Sequence
>LE_HBa0195O08_T7_258416 (raw untrimmed)
GACTGCAGGCATGCAAGCTTTCTGTTTTTTCTAAATGTAATCACTAGAAGTGCTACTGATAATAACGATCCACATAAAAGGGCTGCATAGCCCAATATCA
TCATACTTACGTGCATTATTAACCACTCAGATTGAAGAGCAGGTACTAAGATTCCAGATTGGTGTATTTCAGTTAAAATACCTGAAGTAGCAAAGCCTTG
GGTCAAAATAGCACTTGGTCCAGTTATTTTACTTAAAATTAAAACATTTTTTTTGAAATATGGAATTATATGAATAAGGGAGAAACTCCATGAAAGGAAA
ATTAATGATTCATATAAATCGCTTAGTGGGAAATGTCCTGAAGAAACCCAACGAGTAACTAATAATCCTGTTATACAGAAAAAAGTAACTATTATGCCCT
TTTCTGACGAATCGTATAGTTTTACAATTTCATCGACTAAAAAGGTTATCAAATGAATTGTAATTACAATTGAAACGATCGAAAAGGAAATGTGAGTTAA
TATATGCTCTAACGTTGAAAATATCATAAAAAATCTTAAAAAAGAAGAGTCCCTTAATTACATAATTCTAAAATGGAAATCGGGGATTGAATTCATTATA
AGATCTATTTTATCCCTTTTAGAAAAAGGTTTGCCGCCACTCGGACTCGAACCGAGATGCATTACCCCTGCTTCCTAAAAGCCGCCTGGTTCACCCATTT
CCCCCATACCGGGCTGGTCTTGGAACCCCTAAAAGCCTAACAAATAAGCCACTCCCCCAAAATGGAATAAACCTATTTTACATTTATCGCAGGACTTCCC
AATGGGTTCCCTACCCCATCCACAAGCTTACTCCCAAATTGGAATTTCCAAGGCTGAAAGGTTCCACTTCATCTTCTGACCTCGGGTTTTAAAAAGCTCT
TGCTTTCTCTTTCTTTCTCACTGAATACCCTCTCCCACTAATTTTCCCGCTTTACCCCACAAATTCTCAC
>LE_HBa0195O08_T7_258416 (trimmed for quality and cloning vector)
AGGCATGCAAGCTTTCTGTTTTTTCTAAATGTAATCACTAGAAGTGCTACTGATAATAACGATCCACATAAAAGGGCTGCATAGCCCAATATCATCATAC
TTACGTGCATTATTAACCACTCAGATTGAAGAGCAGGTACTAAGATTCCAGATTGGTGTATTTCAGTTAAAATACCTGAAGTAGCAAAGCCTTGGGTCAA
AATAGCACTTGGTCCAGTTATTTTACTTAAAATTAAAACATTTTTTTTGAAATATGGAATTATATGAATAAGGGAGAAACTCCATGAAAGGAAAATTAAT
GATTCATATAAATCGCTTAGTGGGAAATGTCCTGAAGAAACCCAACGAGTAACTAATAATCCTGTTATACAGAAAAAAGTAACTATTATGCCCTTTTCTG
ACGAATCGTATAGTTTTACAATTTCATCGACTAAAAAGGTTATCAAATGAATTGTAATTACAATTGAAACGATCGAAAAGGAAATGTGAGTTAATATATG
CT

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.938051
Expected error %
0.179853
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAC88095.1| Score 221 E Value 8e-57 Identity 24.20% Align. Length 491bp (97.81%) Frame 1
ccsA protein [Atropa belladonna] ref|NP_783281.1| cytochrome c biogenesis protein [Atropa belladonna]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA77395.1| Score 218 E Value 7e-56 Identity 24.00% Align. Length 491bp (97.81%) Frame 1
c-type cytochrome synthesis protein [Nicotiana tabacum] ref|NP_054556.1| cytochrome c biogenesis protein [Nicotiana tabacum] pir||A05213 cytochrome c-type synthesis protein homolog - common tobacco chloroplast sp|P12216|CCSA_TOBAC Cytochrome c biogenesis protein ccsA prf||1211235CN ORF 313
Nicotiana tabacum Chloroplast (screening/organelle/nicotiana_tabacum_chloroplast)NCBI BLAST
gi|11465934|ref|NC_001879.1| Score 805 E Value 0 Identity 95.10% Align. Length 493bp (98.21%) Frame 1
Nicotiana tabacum plastid, complete genome
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0195O08
Clone
Clone name
hba-195o8
LE_HBa0195O08
P195O08
Clone type
BAC
Contamination
none
Estimated length
85,999
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found