Clone Read LE_HBa0195O15_T7_258424

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0195O15_T7_258424
Primer
T7
ID from Seq. Facility
LE_HBa_195_O15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
404 trimmed for vector and quality, 863 raw
Genbank Accession
Sequence
>LE_HBa0195O15_T7_258424 (raw untrimmed)
GTCGACGATGAAGTGGAAGATGATACTGTACTTTTGGAACCTATTACACAAAGAAACACTTATCACATCTAGAACTCTTTACAATTTTATGGTGCAATTA
AAAAAGACAACATCGAAGCTCGTTGATGCAATAAGAAAAGTTAGAAATGAGATTCAACTAGATTTTTTTTATTTTTTACTTTTAAAATAGAACACAATAA
AATCATATTTCATTAAATTGTCTTTAGAAATATTTGTACTTTTGAAGAATTATTAATTTATGATATTAATAGGACCATATATTTATATCGAAATCTTCTA
AAAATATATTATCTTATTATATTATCGAAATTGGTGATTTTTTTCCATTGGTTCAAGTCGAGACCGAAGGAAACTATTATTTTACAGAGATTATTAATTT
ACTGATATAAATTTATAGAAATTTTACTATATAGTGCAATTATTTAATGCGGTATGAATGTAAGCAAGTATATGTTCGGTAATTATTTTGCCTCTATCGC
GATCTGCCCAATTTCCCCCAATAAATACACGTCCCTATTCACAATTCCAAAAAATTCCCAGAATGCCTAATCCCTCCAAAAAATCATCACTTCACCCCCC
CTTATATTAGGCTCGAAATTTTTCCTTCACCGACACCTCATCAATGTCGTAGCCTCCAGACCGGACTGCCTCCCCTACAGCTAAAATCTTCTTAATTTAC
CCCCACCACATTACATTTAAACACAAATACCCATACCTTCCTTTTGTAAACTTCCCGCATAGGATCAATCAGCTCCCCTCTAGTATTGAAACTGGCCACA
ACTACCCCTCCCCCCCCACTGCCCCCCACTCCCCCCTCCCACTCCTACCTACCACACCTACTT
>LE_HBa0195O15_T7_258424 (trimmed for quality and cloning vector)
ATACTGTACTTTTGGAACCTATTACACAAAGAAACACTTATCACATCTAGAACTCTTTACAATTTTATGGTGCAATTAAAAAAGACAACATCGAAGCTCG
TTGATGCAATAAGAAAAGTTAGAAATGAGATTCAACTAGATTTTTTTTATTTTTTACTTTTAAAATAGAACACAATAAAATCATATTTCATTAAATTGTC
TTTAGAAATATTTGTACTTTTGAAGAATTATTAATTTATGATATTAATAGGACCATATATTTATATCGAAATCTTCTAAAAATATATTATCTTATTATAT
TATCGAAATTGGTGATTTTTTTCCATTGGTTCAAGTCGAGACCGAAGGAAACTATTATTTTACAGAGATTATTAATTTACTGATATAAATTTATAGAAAT
TTTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.866892
Expected error %
1.15758
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89737.1| Score 71 E Value 8e-12 Identity 22.00% Align. Length 176bp (43.56%) Frame 2
hypothetical protein [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38752.1| Score 68 E Value 9e-11 Identity 21.60% Align. Length 170bp (42.08%) Frame 2
hypothetical protein PGEC568H16.8 [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0195O15
Clone
Clone name
hba-195o15
LE_HBa0195O15
C06HBa0195O15
P195O15
Clone type
BAC
Contamination
none
Estimated length
120,541
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found