Clone Read LE_HBa0196C12_T7_258517

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0196C12_T7_258517
Primer
T7
ID from Seq. Facility
LE_HBa_196_C12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
627 trimmed for vector and quality, 985 raw
Genbank Accession
Sequence
>LE_HBa0196C12_T7_258517 (raw untrimmed)
NCATACTGCGGGGACTCTGAGTCGACTGCAGGCATGCAGCTTCTACAATAGGTTTGAAAAACATGTTGTTTGATTTGTGGCACAAGGAACACATTGAAGG
TACGAGGATTATAAAAATGTAAAAAGTATAAAGTTCATAATTTATATTAATTATTATTGTTATTCCAAAGTCGTAATCGACCTAGATATCGAAATTGTTG
ACTCATGATTATCTTAATATATATAAAAAGAGGACGGTTCTCTTTTTTCTATCTGAAATATATGGTAGAGGGAAAAAAAATAGAACTTGAATATTGAGTG
TGGAAATTCACATGTATGTTCCAAACAAACATATGAATCATGTCTTATGTGTACAGGAACATTTGTCTTCTTATTTAGCCGACGGCATTTCCTAAGATAA
AATATTTCTTTTTTCTCATTTTGTCTAATAATTATTCTTTTCTTTATAAAAAAATATTTCTATGTTTAATTTATCAAATCAAGACATTCAAAATTCAAAT
ATTCCCTGAAATCATATACTCCAAAAACAAACTCCCAAAAGTAAAAAGAAAACGTTGGTAGCGTCTTTTTTTCGTTTTATATTTAATTCCCCTTGAGATT
TACGTGGAGAACAGAGTATGAGCCGCCATACTTTCTTGACCATAAGCTTCCACGTTTTTCCTCGCTTATTGGCTGCCGTGTTTGAGACTTTTATGGAGCA
CCAGTTAAAGAGGAATCTACCGAGGGTATATTTCTATCGCATAAGAAAGGCGTGGGACATTTGGGTAATTTGAATCCATTTTGGGTTTTATTTTTTTTTT
AAGTTTTTTGTACAACGTGGTTTTAAATTCCCAAATTGAAATTATTTCCGAATTGGGTTTAAAATAATTTTGGGTTGGGATTTTTGTAATTTCCGAATTT
TTTTAAAGGGGGGCCGGTTTTTAGGGGGGTTTTTTAAAAATTTTTAACAAAATTCCCATAAAATTTTTTTTTGGTTGTGATTTTC
>LE_HBa0196C12_T7_258517 (trimmed for quality and cloning vector)
GCAGGCATGCAGCTTCTACAATAGGTTTGAAAAACATGTTGTTTGATTTGTGGCACAAGGAACACATTGAAGGTACGAGGATTATAAAAATGTAAAAAGT
ATAAAGTTCATAATTTATATTAATTATTATTGTTATTCCAAAGTCGTAATCGACCTAGATATCGAAATTGTTGACTCATGATTATCTTAATATATATAAA
AAGAGGACGGTTCTCTTTTTTCTATCTGAAATATATGGTAGAGGGAAAAAAAATAGAACTTGAATATTGAGTGTGGAAATTCACATGTATGTTCCAAACA
AACATATGAATCATGTCTTATGTGTACAGGAACATTTGTCTTCTTATTTAGCCGACGGCATTTCCTAAGATAAAATATTTCTTTTTTCTCATTTTGTCTA
ATAATTATTCTTTTCTTTATAAAAAAATATTTCTATGTTTAATTTATCAAATCAAGACATTCAAAATTCAAATATTCCCTGAAATCATATACTCCAAAAA
CAAACTCCCAAAAGTAAAAAGAAAACGTTGGTAGCGTCTTTTTTTCGTTTTATATTTAATTCCCCTTGAGATTTACGTGGAGAACAGAGTATGAGCCGCC
ATACTTTCTTGACCATAAGCTTCCACG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.931739
Expected error %
0.197631
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0196C12
Clone
Clone name
hba-196c12
LE_HBa0196C12
C03HBa0196C12
P196C12
Clone type
BAC
Contamination
none
Estimated length
92,973
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found