Clone Read LE_HBa0125F09_SP6_259835

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0125F09_SP6_259835
Primer
SP6
ID from Seq. Facility
LE_HBa_125_F09-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
0 trimmed for vector and quality, 1017 raw
Sequence
>LE_HBa0125F09_SP6_259835 (raw untrimmed)
NNCCAGACTGCGCAGTCGATCAGAGGATCCCGGGATACCGAGCTCGAATTCGCCCTATAGTGAGTCGTATTACAATGCACTGGCCGTCGCTTTTCAACGT
CGTGGACTGGGAAAACCCTGGCGGTACCCAACTTAATCGCCTTGCAGCAGCATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCG
CGCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGGATGTCACACCGCATATGGTGCACT
CTCAGTACAATCTGCTCTGATGCCGCATAATAAAGCCAGCCCCGACACCCGCCAACACGCGCTGACGCGAACCCCTAGCGGCCGCCTCGAGCATAACTTC
GCAAGGGGTATGCAACACGAAACCACTAGCGAGGAACTCGGACTTCCATTGCTCGGGCCCGGACGAAAGGTTATAAAGGATGAATACAATAGACAATATT
CTCATATTCAAGCCAGACCTGCCGAACACTTCTATTACGCCCATATAATAGTAAGATTAGATGGTTACGCTCTAGTGAAAGTGATACTCTAAATGAAGTT
ACTCGACAAAGTCAAAGCCAGCCTAAAAGGTCGCCTCACTTCTTCAGGTGAAATCCCAGAAATGTGAATGTTAATACTGGTATAAGAATGGACAACATTC
CCCTATAGGCATTTAAAGAAAACGATACGCGCTNATNTCATGTAGGGAAAGTGCCTGCAAAGAACCTTTTGATTCGCAACTCATTCTTATTTAGTCCAAG
CATCCGAAAATAGAAAACCGGTAACGGCCATCAGGANNGTNNNCTGGNNTGGAATTGGGGTTACATGTTTAGTTGATACAATTAAAGAACTCAGATGTTT
TACTAATACATCTTCTATTTTTAGGACAATGCTTAAAACAAAAACATTGGTTCCCTTGAACACTCAACATCAACAGTAACTTGTCATTTTCGTTACTACA
TAGATATTGTTACTCAG
>LE_HBa0125F09_SP6_259835 (trimmed for quality and cloning vector)

This is probably not a useful sequence.

Problems:
  • Short cloning insert
  • Low complexity
  • High predicted error rate
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
3' read, short insert
Quality trim threshold
14.5
Sequence entropy
not recorded
Expected error %
100
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0125F09
Clone
Clone name
hba-125f9
LE_HBa0125F09
P125F09
Clone type
BAC
Contamination
none
Estimated length
61,495
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found