Clone Read LE_HBa0125H08_SP6_259918

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0125H08_SP6_259918
Primer
SP6
ID from Seq. Facility
LE_HBa_125_H08-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
540 trimmed for vector and quality, 866 raw
Genbank Accession
Sequence
>LE_HBa0125H08_SP6_259918 (raw untrimmed)
GATTCTCTACTTAGAACGAAATTGAGAGACACACAGCGTATCGACTCTTTTGGTTGACTTTAGCATCTTCAGGATAAGTTCCAGACTCTAAAAACTTCTT
TACATCAAAATACCAAGGCAAATCGTCTGGTTCTGTTTCAACATGGGAACAATGGAGTAGATGTTCTTTTAGTTCTATATCCAGAGGATTAATGTAATCA
GTATCCGGATGTTTAATCATCAAAGAAATGGTGGCAAGAGCATCGGCCAGTTCATTCTGTATTCTGGGAGTATGTCTGAACTCGATTTTACGGAATCTTT
TCCACAACTCCTGCACATATTGTACGTAAGGTATAATCTTTGGGTTTTTCACAGCCCATTCTCCTTGAACTTGATGAATTAAAAAATCTGAATCTCCAAT
AACCAACAACTCATAGACATTCATATCGATGGCCATTTTCAAATCAAGAATACAAGCTTCGTATCCGGCCATGTTGTTTGTGCAATTAAATCGGAGCATA
GCTGCCATGGGATAGTGTTGACCAGATTCTGACGCGAAGACTGCTCCAATACCTTTACCATGATGATTTTCCGCTCTGTCAAAGAATAATCTCCAACATG
GATATGCTTTAGGAATATCCCTCCCCACTAACGACACTTCTTTCTCATAAAAAGAAGTTTTTTATTGGGTCTATCTCGTCATCAACGGGATTTTCATCAA
AATAATCACCCAAATTCTGTGCCCTTTATTGCTTCTGAAATCATTTCTGAAATAAAATTTCCCTCACCTACCATTTCCAATTTTCTAATTTTTCGATAGG
GATCACTTTCTTAAAAATATTTTCAAGGAACCCTTTCTAAAAAGTAGAATTTTTTCTGTCCATAAA
>LE_HBa0125H08_SP6_259918 (trimmed for quality and cloning vector)
TCTCTACTTAGAACGAAATTGAGAGACACACAGCGTATCGACTCTTTTGGTTGACTTTAGCATCTTCAGGATAAGTTCCAGACTCTAAAAACTTCTTTAC
ATCAAAATACCAAGGCAAATCGTCTGGTTCTGTTTCAACATGGGAACAATGGAGTAGATGTTCTTTTAGTTCTATATCCAGAGGATTAATGTAATCAGTA
TCCGGATGTTTAATCATCAAAGAAATGGTGGCAAGAGCATCGGCCAGTTCATTCTGTATTCTGGGAGTATGTCTGAACTCGATTTTACGGAATCTTTTCC
ACAACTCCTGCACATATTGTACGTAAGGTATAATCTTTGGGTTTTTCACAGCCCATTCTCCTTGAACTTGATGAATTAAAAAATCTGAATCTCCAATAAC
CAACAACTCATAGACATTCATATCGATGGCCATTTTCAAATCAAGAATACAAGCTTCGTATCCGGCCATGTTGTTTGTGCAATTAAATCGGAGCATAGCT
GCCATGGGATAGTGTTGACCAGATTCTGACGCGAAGACTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.967648
Expected error %
0.172095
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g01410.1 Score 65 E Value 2e-11 Identity 11.00% Align. Length 299bp (55.37%) Frame 3
68416.m00064 RNase H domain-containing protein low similarity to GAG-POL precursor [Oryza sativa (japonica cultivar-group)] GI:5902445; contains Pfam profile: PF00075 RNase H
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU90285.1| Score 169 E Value 3e-41 Identity 18.00% Align. Length 422bp (78.15%) Frame 3
putative gag/pol polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT39963.1| Score 167 E Value 2e-40 Identity 16.70% Align. Length 449bp (83.15%) Frame 3
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0125H08
Clone
Clone name
hba-125h8
LE_HBa0125H08
P125H08
Clone type
BAC
Contamination
none
Estimated length
79,127
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found