Clone Read LE_HBa0125O10_SP6_260216

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0125O10_SP6_260216
Primer
SP6
ID from Seq. Facility
LE_HBa_125_O10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
426 trimmed for vector and quality, 956 raw
Genbank Accession
Sequence
>LE_HBa0125O10_SP6_260216 (raw untrimmed)
TCGTGCATAAATCGGAGCTTCGCTGTCATGGGATAATGGTGACTAGATTCTAGCACTAAGACTGCTCCGATGCCTTTCCCTTTATGATTTTCCGCTCCAT
CAAAGAATAGTCACAACCTGGATATGCTTCAGAAATATCTTCACCTACAAATGACACTTTTTCATCGTGAAAATAAGTCTTAAGTGGTTCATACTTTTCA
TCAACGGGATTTTCTGCAGGATGATCAGCTAAATCCTGTGCTTTTATCGCCTTCTGAGTCACATATACAATATCAAACTCACTCAACAGCATTGGCCACT
TAGCTAATTTTCCAGTCGACATCACCTTTCGGAAGTTATACTTCAGCAGATCAATTCTAGAAATGAGGCATGTAGTATAAGAAGACAAATAATGTCTCAA
CTTCTGTGCAAGCCAAGTCAAAGCACAACACTTCCTCTCTGACAAAGTGTAACGAGACTGTTATGGAGTAAACTTCTTACTTATGAAATAGATACCCTTA
TCCTGTTTTGAATATCGTGTCCTGTTGAACAATTACGCATTCAAATGCACTATTTGAGATTGACAAATCCGGTAATTATGGGACCCCATTCTCATGAAAG
AACCATTCGCGAAAGGTATCAACAGTTGTTTTAATATGTTTGAAAGGGTCTAATTACCATTGTTAGTTAAATGCTTGTTCTAATGGAAGAACGTTTTATA
TTGTTAATTATTTTGATAACAATATTTCTAGCAAATGATATCTATATGTCGATTAAGCATATTCATTTTATTTAAATAACCTAATGTTTAATATCACAAT
CTGATACGTGTATAAGATATTCTTTTGTTAATTAATTTCAACATTATATTTACATTAAATTCAATTTAATAACTCCATAGAGATGGAGCGTACAAATTAA
TAATATTGTTTGTATTTCTCGATTTACGTAGATAATTAGAATAGTATTTATAGAAT
>LE_HBa0125O10_SP6_260216 (trimmed for quality and cloning vector)
AAATCGGAGCTTCGCTGTCATGGGATAATGGTGACTAGATTCTAGCACTAAGACTGCTCCGATGCCTTTCCCTTTATGATTTTCCGCTCCATCAAAGAAT
AGTCACAACCTGGATATGCTTCAGAAATATCTTCACCTACAAATGACACTTTTTCATCGTGAAAATAAGTCTTAAGTGGTTCATACTTTTCATCAACGGG
ATTTTCTGCAGGATGATCAGCTAAATCCTGTGCTTTTATCGCCTTCTGAGTCACATATACAATATCAAACTCACTCAACAGCATTGGCCACTTAGCTAAT
TTTCCAGTCGACATCACCTTTCGGAAGTTATACTTCAGCAGATCAATTCTAGAAATGAGGCATGTAGTATAAGAAGACAAATAATGTCTCAACTTCTGTG
CAAGCCAAGTCAAAGCACAACACTTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.963535
Expected error %
0.18383
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT39963.1| Score 150 E Value 4e-36 Identity 71.70% Align. Length 352bp (82.63%) Frame 2
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU90285.1| Score 148 E Value 1e-43 Identity 70.70% Align. Length 421bp (98.83%) Frame 2
putative gag/pol polyprotein, 3'-partial [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0125O10
Clone
Clone name
hba-125o10
LE_HBa0125O10
P125O10
Clone type
BAC
Contamination
none
Estimated length
102,979
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found