Clone Read LE_HBa0137E13_SP6_260377

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0137E13_SP6_260377
Primer
SP6
ID from Seq. Facility
LE_HBa_137_E13-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
612 trimmed for vector and quality, 881 raw
Genbank Accession
Sequence
>LE_HBa0137E13_SP6_260377 (raw untrimmed)
TCCGGGTAATGGGATGATCACCTACCAGTTGCTGAATTCGCTTATAACAATAGCTACCATTCAAGAATTAAAATAGCACAATATGAAATTTTATATGGCC
GAAAGTGTAGATAAACCAATTGGATGGTTCGAAACAGGTGAAACAACCTTATTTAGGCCTAATGTTGTGCATCACTCTATGGAGAAAGTCAAAGTGATAC
AACAACGGCTAGAAACAACTCAAAGTCGACATAAATCATGTGTGGATATTAGAAGGAGATGACCAGAATTTTCTATAGGGGATTGGGTGTTCTTGAAGGT
GTAATAAAAGGGGTAATGAGGTCTAGTAAAAAGGTAAAGTTGAGTCCATACTATATAGGGACGTATAAGATTATTGGAAAAGAAGGCCAAGTAGCATATG
AGTTGGAGCTACCACAAAAGCTCATGTCTTAATGCATCAAAAATGCATAGGTGACCTATATTACTCCTACTGAAGATGTACAAGTTGCGGGAGATCTCAC
TTATGAAGAAGTACTCATTGATATTCTGGATCGACAAGTTAGGAAGTTAAAAAATAAAGAAGTAGCTTCAGTAAAAGTAATATGGGGAAACCAACAAATA
GAAGAAGTTACATGTGAAGCGGAAGAAGCAATTAAATTGAAGTATCCTCATCTTTTTCACACTTTGTGATTCCGATCAAAATGTTATTGGAAGGGTTTGA
CATAGTAGTTTTAATTTTTTATGGTTCCACCCTAACTGTATGCTTTGAACCTTGTTTTAGGTTGGACAATCCTTACTTTACTTTTTCCTGAAAAAATTGT
TTTCGGGAGGGGGGGGAAAATCTTTATTTTTTGCTACTACTATACATCATAGCATCATCTTATCATTTCTTTTCACTTCTA
>LE_HBa0137E13_SP6_260377 (trimmed for quality and cloning vector)
TGGGATGATCACCTACCAGTTGCTGAATTCGCTTATAACAATAGCTACCATTCAAGAATTAAAATAGCACAATATGAAATTTTATATGGCCGAAAGTGTA
GATAAACCAATTGGATGGTTCGAAACAGGTGAAACAACCTTATTTAGGCCTAATGTTGTGCATCACTCTATGGAGAAAGTCAAAGTGATACAACAACGGC
TAGAAACAACTCAAAGTCGACATAAATCATGTGTGGATATTAGAAGGAGATGACCAGAATTTTCTATAGGGGATTGGGTGTTCTTGAAGGTGTAATAAAA
GGGGTAATGAGGTCTAGTAAAAAGGTAAAGTTGAGTCCATACTATATAGGGACGTATAAGATTATTGGAAAAGAAGGCCAAGTAGCATATGAGTTGGAGC
TACCACAAAAGCTCATGTCTTAATGCATCAAAAATGCATAGGTGACCTATATTACTCCTACTGAAGATGTACAAGTTGCGGGAGATCTCACTTATGAAGA
AGTACTCATTGATATTCTGGATCGACAAGTTAGGAAGTTAAAAAATAAAGAAGTAGCTTCAGTAAAAGTAATATGGGGAAACCAACAAATAGAAGAAGTT
ACATGTGAAGCG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.952835
Expected error %
0.121403
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38724.1| Score 148 E Value 9e-35 Identity 49.00% Align. Length 611bp (99.84%) Frame 2
putative retrotransposon protein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38792.1| Score 141 E Value 1e-32 Identity 45.60% Align. Length 611bp (99.84%) Frame 2
putative gag-pol polyprotein [Solanum demissum] gb|AAT38791.1| putative gag-pol polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0137E13
Clone
Clone name
hba-137e13
LE_HBa0137E13
P137E13
Clone type
BAC
Contamination
none
Estimated length
107,578
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found