Clone Read LE_HBa0137J06_SP6_260479

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0137J06_SP6_260479
Primer
SP6
ID from Seq. Facility
LE_HBa_137_J06-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
667 trimmed for vector and quality, 875 raw
Genbank Accession
Sequence
>LE_HBa0137J06_SP6_260479 (raw untrimmed)
NCCGTCNCATAGAGATTCCCGAGTATTTTTTGTTATAGTCTCTAAGGTTAGCCCCATTTTATTGACCACACCATGCCGGTAAGTTTTAGGTCCAACTCAT
ACTAAAATAGTAAGAATTATTTTTTGCAGAGTGGCATGGTGTGGCAGTTCTTGCATTTTTCAAAGTCAATATATATTTCAACAATATTAGTATCAGTCTC
CCAAAGGAACCTCTCCTAAAATAATTTCCCAAAAAAACGAAAATGTGATTGGATTGCTTGTCTCCATTTTCATTCTTCCTCTTTCACCTTCTTTACTTTA
CTCCTCAACAGAACGAGGATTTCCACATCATGCATGCAAAAAACAAAGTGCACGTAAAAGGTAAATTACTGTAATAAAAATGAGAGTAGTTGATAATATA
CGCCGATTGCCAAACCTGTCCAGACCCTGTGACAAAAGCAGCATGATTATGAGAAGCTGAAACTTGCGCAACTTGTACGGGAACAGGAAAGCTAATTCGA
GTAAATTCCACACACTGAGTTGTTTCAGGCCCATGACCAAGGACGCCGCATAAACTGGAACCACAAGAGTATGCTGCTGAATCATTGATTAGCAGTGTGT
GATACCTGCCACTCCTTATTTGCATCTGCCAAGAACTTTTTACAGTAAGTAATAACAAAAGATGAAGTCCTAGCTGCAGACTATTCTAGTAGAAGCGAGT
AACTAAAATCTAGAAATATTAAGGTAGAAATCAATCAGCAACTTAAACCCTCGATCATTAAAACCGTTATCCATTCCATTCAATTTGGTCCCCATTTCAA
TTGCAATACCAAAAAAATTTCCTTAAACCTTTAAATACAATTCCCTTTAACCAAACAAATAAAAAGATTCCCCTG
>LE_HBa0137J06_SP6_260479 (trimmed for quality and cloning vector)
CCGAGTATTTTTTGTTATAGTCTCTAAGGTTAGCCCCATTTTATTGACCACACCATGCCGGTAAGTTTTAGGTCCAACTCATACTAAAATAGTAAGAATT
ATTTTTTGCAGAGTGGCATGGTGTGGCAGTTCTTGCATTTTTCAAAGTCAATATATATTTCAACAATATTAGTATCAGTCTCCCAAAGGAACCTCTCCTA
AAATAATTTCCCAAAAAAACGAAAATGTGATTGGATTGCTTGTCTCCATTTTCATTCTTCCTCTTTCACCTTCTTTACTTTACTCCTCAACAGAACGAGG
ATTTCCACATCATGCATGCAAAAAACAAAGTGCACGTAAAAGGTAAATTACTGTAATAAAAATGAGAGTAGTTGATAATATACGCCGATTGCCAAACCTG
TCCAGACCCTGTGACAAAAGCAGCATGATTATGAGAAGCTGAAACTTGCGCAACTTGTACGGGAACAGGAAAGCTAATTCGAGTAAATTCCACACACTGA
GTTGTTTCAGGCCCATGACCAAGGACGCCGCATAAACTGGAACCACAAGAGTATGCTGCTGAATCATTGATTAGCAGTGTGTGATACCTGCCACTCCTTA
TTTGCATCTGCCAAGAACTTTTTACAGTAAGTAATAACAAAAGATGAAGTCCTAGCTGCAGACTATT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.966324
Expected error %
0.0836267
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g15430.2 Score 106 E Value 1e-23 Identity 23.10% Align. Length 224bp (33.58%) Frame 3
68416.m01958 regulator of chromosome condensation (RCC1) family protein low similarity to UVB-resistance protein UVR8 [Arabidopsis thaliana] GI:5478530; contains Pfam profile PF00415: Regulator of chromosome condensation (RCC1)
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g15430.1 Score 106 E Value 1e-23 Identity 23.10% Align. Length 224bp (33.58%) Frame 3
68416.m01957 regulator of chromosome condensation (RCC1) family protein low similarity to UVB-resistance protein UVR8 [Arabidopsis thaliana] GI:5478530; contains Pfam profile PF00415: Regulator of chromosome condensation (RCC1)
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_912081.1| Score 112 E Value 8e-24 Identity 21.90% Align. Length 227bp (34.03%) Frame 3
putative UVB-resistance protein UVR8 [Oryza sativa (japonica cultivar-group)] dbj|BAC57847.1| putative UVB-resistance protein UVR8 [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAF35409.1| Score 106 E Value 4e-22 Identity 23.10% Align. Length 224bp (33.58%) Frame 3
unknown protein [Arabidopsis thaliana] gb|AAN12924.1| unknown protein [Arabidopsis thaliana] dbj|BAB02372.1| unnamed protein product [Arabidopsis thaliana] ref|NP_566512.1| regulator of chromosome condensation (RCC1) family protein [Arabidopsis thaliana] ref|NP_974323.1| regulator of chromosome condensation (RCC1) family protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0137J06
Clone
Clone name
hba-137j6
LE_HBa0137J06
C07HBa0137J06
P137J06
Clone type
BAC
Contamination
none
Estimated length
79,015
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found