Notice: The contact form functionality has been restored. Apologies for any inconvenience.

Clone Read LE_HBa0137K15_SP6_260508

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0137K15_SP6_260508
Primer
SP6
ID from Seq. Facility
LE_HBa_137_K15-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
430 trimmed for vector and quality, 875 raw
Genbank Accession
Sequence
>LE_HBa0137K15_SP6_260508 (raw untrimmed)
TCACGACTTCAACATGGTATCGAAGTACATATAATAAAAAGAACTTCCCCTTGGATTTTTGAAAGATTTTCCTTTCTCTGAGGAATGACCCTTGCCGGTT
TATCGGAATCATCTCATTAGCTTTAAGAGTCATCTAAGTAAAAGAACAACTACCGACACCAACTCTATCTTAACGATCGGTAAAGCCTTCTCTCTAGGAT
ATGGCACTTCACTGCTCGGAGAGGAATGAATTCTTCTCCAATCCATCTCTTCCTTTATTTAAGTTGAGAAAGAAGTCAATCACGTACACGAAGGTTGTGT
AGTCCCCTATATTTACATCCAGATGAGAAAAACAAAAACCTACTTAAATCTTCTCACAAGGAATCAAATAGATCTCTAACTCCTCCATTAAGCTATGTCC
TTTCTCTTTCATGTAGCTTCCAAAGTCCCACTCCTCCTTAGACTGCATTGTCGTACTTCTATACCTTCGCCTCCATACCATGTCTTAAGGTCGATCGCCC
CTTATGCTTATAGTGGAAGCTAGCTTAACCCTTTAAGCTGAAATATATTGGTAGAATGATCCTATCAATCTTTTTATATTTGGAATTCCAAAATGGTTTT
GAACCTATGTTCAATATCACTAGCATCATGGGACCTCTTAGTATCATTCATAAGGTTTTTTTTCCATGTGGGCATACATCTGACAAAAATGTTGTTATAC
TGTTATTTTTATTAAATGTGGTGGCACATTTTTATTGGCAATATTACATGGGTTTAGTGTATTTATATTATCTTTTTCATTTCTAGACTTTACATTTTAT
TTTGCTCTCTTCACTCTTTTTATATCCTTTCTCCTTGTTCTAATTGTACTTTACTTTTTCTTCATAAATTTTTTT
>LE_HBa0137K15_SP6_260508 (trimmed for quality and cloning vector)
CTTCAACATGGTATCGAAGTACATATAATAAAAAGAACTTCCCCTTGGATTTTTGAAAGATTTTCCTTTCTCTGAGGAATGACCCTTGCCGGTTTATCGG
AATCATCTCATTAGCTTTAAGAGTCATCTAAGTAAAAGAACAACTACCGACACCAACTCTATCTTAACGATCGGTAAAGCCTTCTCTCTAGGATATGGCA
CTTCACTGCTCGGAGAGGAATGAATTCTTCTCCAATCCATCTCTTCCTTTATTTAAGTTGAGAAAGAAGTCAATCACGTACACGAAGGTTGTGTAGTCCC
CTATATTTACATCCAGATGAGAAAAACAAAAACCTACTTAAATCTTCTCACAAGGAATCAAATAGATCTCTAACTCCTCCATTAAGCTATGTCCTTTCTC
TTTCATGTAGCTTCCAAAGTCCCACTCCTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.944821
Expected error %
0.243599
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0137K15
Clone
Clone name
hba-137k15
LE_HBa0137K15
C03HBa0137K15
P137K15
Clone type
BAC
Contamination
none
Estimated length
107,982
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found