Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

Clone Read LE_HBa0140O20_SP6_261257

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0140O20_SP6_261257
Primer
SP6
ID from Seq. Facility
LE_HBa_140_O20-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
592 trimmed for vector and quality, 964 raw
Genbank Accession
Sequence
>LE_HBa0140O20_SP6_261257 (raw untrimmed)
CATGTAGAACAATTCTTGAGTGATACAGAGATATTGAAGACTTATCAAGTAGTAATATTTAGTTAATGAATCACGAAAAGCAGACCAAAAATGAAACAGT
CCAAGCTAGAGTTGGGCATAAACTCATAGATTAGCATCTTTTCTTCTCCTTCAAGGCAGCAACCCAAAAGCTTGACAAGGTTTCTATGTTGCAGCTTGGA
AATGAAAACAATTTCATTTTTTAACTCTTGAACGCCTTGTCCAGAATACTTCGATAGCTTCTTTACTGCTATCTCTTGTCCATCTGGTAGAATACCCTGC
GATTTTCTCTCAAGGGTCAAATATTTTCCCTTCTCGCTTTTAGTTGAAGATCAAAGTTGATTTACCTTGTAAACCTGTCCAAAGCCACCCTCACCAATCA
CATTCGCAGAAGAGAAACTTTCAGTGGAAGTAGTAACAGTAACTAAATCAAACAATGGCAACTCAAGGTCATTCTTTCCAACTTCTGAACCTGTCAACAT
ATATTTTCCGATCACAGACATGATATAATTGAACTTTTCCTCAATCATTTGATAAAGTCGAACATGTTAGCTAGATGGAGGTAGAAAAGCATTCACAGTT
AACAATTTTCTAATACCTCCAGTATGTTTGTCTGTTTTTTTGTTCCTTCCTTGGAAAGGAAACCAAGCTACAAAGATGAGGATAAAAAGTGCCTGCTAGT
GCCGAAATGACCCCCATCAGAGCTGGCCACTTTCCCCTCCAAGTCTCTGAATGGAATTGGTTTAATACAAAAAAACGTCCATAAAGCAGTCTTTCCAATT
AAATGAAATTGACAATAATCTATTTGGAAATTGCCTTCCGCCACAATTTCATTGACCTTTAAAATAATAAAATTTCCCCTTAAAATCTCAACAAAGGGGT
TGCTCTTATTTGTTGCAAAAAAAAACACTTAAATAAGGTTTTATGAAATGGGGTTCATTTCTCG
>LE_HBa0140O20_SP6_261257 (trimmed for quality and cloning vector)
ATTCTTGAGTGATACAGAGATATTGAAGACTTATCAAGTAGTAATATTTAGTTAATGAATCACGAAAAGCAGACCAAAAATGAAACAGTCCAAGCTAGAG
TTGGGCATAAACTCATAGATTAGCATCTTTTCTTCTCCTTCAAGGCAGCAACCCAAAAGCTTGACAAGGTTTCTATGTTGCAGCTTGGAAATGAAAACAA
TTTCATTTTTTAACTCTTGAACGCCTTGTCCAGAATACTTCGATAGCTTCTTTACTGCTATCTCTTGTCCATCTGGTAGAATACCCTGCGATTTTCTCTC
AAGGGTCAAATATTTTCCCTTCTCGCTTTTAGTTGAAGATCAAAGTTGATTTACCTTGTAAACCTGTCCAAAGCCACCCTCACCAATCACATTCGCAGAA
GAGAAACTTTCAGTGGAAGTAGTAACAGTAACTAAATCAAACAATGGCAACTCAAGGTCATTCTTTCCAACTTCTGAACCTGTCAACATATATTTTCCGA
TCACAGACATGATATAATTGAACTTTTCCTCAATCATTTGATAAAGTCGAACATGTTAGCTAGATGGAGGTAGAAAAGCATTCACAGTTAAC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.961391
Expected error %
0.165657
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g11330.1 Score 129 E Value 2e-30 Identity 17.20% Align. Length 377bp (63.68%) Frame 2
68414.m01301 S-locus lectin protein kinase family protein contains Pfam domains, PF00954: S-locus glycoprotein family, PF00069: Protein kinase domain, and PF01453: Lectin (probable mannose binding)
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g21390.1 Score 128 E Value 2e-30 Identity 16.90% Align. Length 413bp (69.76%) Frame 2
68417.m03090 S-locus lectin protein kinase family protein contains Pfam profiles: PF00954 S-locus glycoprotein family, PF00069 protein kinase domain, PF01453 lectin (probable mannose binding)
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_478649.1| Score 132 E Value 8e-30 Identity 16.90% Align. Length 401bp (67.74%) Frame 2
putative S-receptor kinase KIK1 precursor [Oryza sativa (japonica cultivar-group)] dbj|BAC65366.1| putative S-receptor kinase KIK1 precursor [Oryza sativa (japonica cultivar-group)] dbj|BAD30706.1| putative S-receptor kinase KIK1 precursor [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA73134.1| Score 129 E Value 4e-29 Identity 17.40% Align. Length 413bp (69.76%) Frame 2
serine/threonine kinase [Brassica oleracea] pir||T14450 serine/threonine kinase (EC 2.7.1.-) BRLK - wild cabbage
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0140O20
Clone
Clone name
hba-140o20
LE_HBa0140O20
C07HBa0140O20
P140O20
Clone type
BAC
Contamination
none
Estimated length
107,096
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found