Notice: The contact form functionality has been restored. Apologies for any inconvenience.

Clone Read LE_HBa0159C06_SP6_261401

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0159C06_SP6_261401
Primer
SP6
ID from Seq. Facility
LE_HBa_159_C06-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
708 trimmed for vector and quality, 968 raw
Genbank Accession
Sequence
>LE_HBa0159C06_SP6_261401 (raw untrimmed)
ACCTTTNNGGACTTTTCATTAGAGATATTATCTTTTATGATGCCCATATCTTATTGAAATTAGACAAATTTACTACCAGAAAATAAGTGTTTTAACCAAT
ATTTGTGAGCCAATTTTCTAATTGATTAATAGGTGCCAACTTATATGCATTTTCTTTTCGCAAGTTATAACTTAGAAACGCTTCTTCAAAAGAATTTTGG
CAAAACACAAACTACTAACGAAAGCAGTTCTCAAACAAGTTAACCAAATACTACGACACCATGGTGCATGTAGTTAAGGCAAGTGCAGACTGAAATAGTG
TGCCTCACTACCACATAGGATCAGTTATTATGTCTTAGTTTAAAATCATGCCCAGTTCTCCTCGCCTAAAATATTAGAAAGGGGGCATTAGTAAAATAGT
TAAATGATGAGGATCAACCTTCTACTCCCATTACCAAACTGGGCGTACTTACAATGTCACTTAAAGTCACCAAGATTCAGATTAAGTTAACACTATTTAT
ATGTTCTTCCATGCTAAATCTCATGTCAAAGAGCATCAGGCATCAGCATCTTCAGTTACTAAAGTTCAATATATCTTACCAAGGAAGGAAATCAAAAACT
ATAAGAAGTGATCAAAAGTAATTAATGGTTCAATTACATAAACACATCAGAAGTCGGAACTATGAGTATATCAAATGCTTTGGAAATTGTTCTGCCTGAT
GACAATTCAACTTTAATGACTGGCCGAAAATCACGAAAAAAGGGAATGACAAACTTGGAAAATCTATCAGTGCAACACGTCCATGGCCCAATTTTGTAAC
TCGAAAACTTCTCCAGCACCACTAGAAACCTATTTTACAGGGCGTAACAGGAAGTTATTGCTTGGTCTTTCGAAAAACCCCAGAACCTGAGAAAAGGTGG
TCGCCACTGAAAAAATAATTAATAGAGACAACTATTTATTGTTGATTGGGTAATATACAACCAATTAA
>LE_HBa0159C06_SP6_261401 (trimmed for quality and cloning vector)
ATCTTTTATGATGCCCATATCTTATTGAAATTAGACAAATTTACTACCAGAAAATAAGTGTTTTAACCAATATTTGTGAGCCAATTTTCTAATTGATTAA
TAGGTGCCAACTTATATGCATTTTCTTTTCGCAAGTTATAACTTAGAAACGCTTCTTCAAAAGAATTTTGGCAAAACACAAACTACTAACGAAAGCAGTT
CTCAAACAAGTTAACCAAATACTACGACACCATGGTGCATGTAGTTAAGGCAAGTGCAGACTGAAATAGTGTGCCTCACTACCACATAGGATCAGTTATT
ATGTCTTAGTTTAAAATCATGCCCAGTTCTCCTCGCCTAAAATATTAGAAAGGGGGCATTAGTAAAATAGTTAAATGATGAGGATCAACCTTCTACTCCC
ATTACCAAACTGGGCGTACTTACAATGTCACTTAAAGTCACCAAGATTCAGATTAAGTTAACACTATTTATATGTTCTTCCATGCTAAATCTCATGTCAA
AGAGCATCAGGCATCAGCATCTTCAGTTACTAAAGTTCAATATATCTTACCAAGGAAGGAAATCAAAAACTATAAGAAGTGATCAAAAGTAATTAATGGT
TCAATTACATAAACACATCAGAAGTCGGAACTATGAGTATATCAAATGCTTTGGAAATTGTTCTGCCTGATGACAATTCAACTTTAATGACTGGCCGAAA
ATCACGAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.947822
Expected error %
0.15916
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0159C06
Clone
Clone name
hba-159c6
LE_HBa0159C06
C03HBa0159C06
P159C06
Clone type
BAC
Contamination
none
Estimated length
104,190
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found