Clone Read LE_HBa0090J13_SP6_26184

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0090J13_SP6_26184
Primer
SP6
ID from Seq. Facility
LE_HBa_090_J13-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
655 trimmed for vector and quality, 973 raw
Sequence
>LE_HBa0090J13_SP6_26184 (raw untrimmed)
CCCGGATTAGCCAAACCAAGTCAATGTAAGAGCCTGGTGATGGTGTTCAGAAGGGATATGTTGGGAGCGGTAAATTTGATCATCCAAATGGGTCCGGCAG
TATTCAGTGCATGGTTTCAAGTCTTGGACATTGACACCAGCTACAACCTCTCTTCTAGGAAGACCTTTTATTCACATGGCTGGAGCTGTGCCTTCTACAC
TGCATTAGCTGATTTAACTCATTTGGAAGAATGAAGAGCTATTCATTTATGGTAAAGGTAGTCTTTCTGGAAAACAGGAGCCGATTCTCGATGAAGTGTC
TCGAGGTATTAATTTCCACACGCTGGAGCTGGTAAATGCAACCGGTGAAGACTTGGCCTCACAACCTCTAATGCCTGCCGTGTACAAGATGATAGCCACT
GTAATGCTGTAGAATGGTTTTGAACTAGGTTTCGATTTGGGAAGAAATTCCCAAGGAATTATTGAGCCTATTTCGGTCCCCATCAAAAGATCCAGATACG
ATTTGGGGTACATCCTCACAGATGATGATGAGAAGACAAAGAAGAAAAAAGATCAAGCATTGGCCAAACCAATCCCTCATCTATATCAATCCTTCCCAAT
CCGTGAATATGCCGAGAAGGAGGACCTCTGGGAAGGATTTTTTGACCTTTTTGAAGAGATTGATGCCATCATTGAAGAAGAGGTTGAGCTGACAAGATTC
CGCGATGCTGATCCAGGAGAGATGCCGTAGTACTGGACCTTCACCCCCATCCTGATTCCCCCGAACTCCCTGGTAGAAAGGCATTCTTTTATGAATATTT
AAATCCGGGCCTATCGGGAAAAGGCTGAAACCTACCATTTTGATTTTTACTTAACTTGTTGATTTTTTTAATTTTCCATCGGGAAATTAAAAGGGAAACA
TACCCTTAGATCCAGAGAAATGTTTTTCACCTTTTTTTCCATTTTAATGGGAGCCCCTCTTTATTTCAACGTT
>LE_HBa0090J13_SP6_26184 (trimmed for quality and cloning vector)
AGTCAATGTAAGAGCCTGGTGATGGTGTTCAGAAGGGATATGTTGGGAGCGGTAAATTTGATCATCCAAATGGGTCCGGCAGTATTCAGTGCATGGTTTC
AAGTCTTGGACATTGACACCAGCTACAACCTCTCTTCTAGGAAGACCTTTTATTCACATGGCTGGAGCTGTGCCTTCTACACTGCATTAGCTGATTTAAC
TCATTTGGAAGAATGAAGAGCTATTCATTTATGGTAAAGGTAGTCTTTCTGGAAAACAGGAGCCGATTCTCGATGAAGTGTCTCGAGGTATTAATTTCCA
CACGCTGGAGCTGGTAAATGCAACCGGTGAAGACTTGGCCTCACAACCTCTAATGCCTGCCGTGTACAAGATGATAGCCACTGTAATGCTGTAGAATGGT
TTTGAACTAGGTTTCGATTTGGGAAGAAATTCCCAAGGAATTATTGAGCCTATTTCGGTCCCCATCAAAAGATCCAGATACGATTTGGGGTACATCCTCA
CAGATGATGATGAGAAGACAAAGAAGAAAAAAGATCAAGCATTGGCCAAACCAATCCCTCATCTATATCAATCCTTCCCAATCCGTGAATATGCCGAGAA
GGAGGACCTCTGGGAAGGATTTTTTGACCTTTTTGAAGAGATTGATGCCATCATT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.975989
Expected error %
0.174796
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89777.1| Score 133 E Value 3e-30 Identity 16.20% Align. Length 443bp (67.63%) Frame 3
gag-pol polyprotein-like [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT39963.1| Score 73 E Value 7e-12 Identity 11.40% Align. Length 554bp (84.58%) Frame 3
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0090J13
Clone
Clone name
hba-90j13
LE_HBa0090J13
P090J13
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found