Clone Read LE_HBa0163E02_SP6_262067

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0163E02_SP6_262067
Primer
SP6
ID from Seq. Facility
LE_HBa_163_E02-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
5 trimmed for vector and quality, 1011 raw
Sequence
>LE_HBa0163E02_SP6_262067 (raw untrimmed)
CAACCTTTATACTCCCCTGCTCCATCCCATACGTCGCTCAAATCACCATTGGCTGCCTCCTTAGGACAAAATGCATGGGTTCAAGCGTGCTCACTGTGCT
CACTTGGCTAAACGATCTCATGAGAAACTCATGTTGCAATAGCTGCCAACTGTCGCTATAGTTAGGATGAAAATCCTTGAACCATTCATGGGCATGTACC
TTTTAGAGAACGGACAAAC
TGTTTGACCGTATAAACGCCATATGTACCAGCATTATTGCATGTTCTCCAAGAAGAGATGCAACATGTTGTTTCAGATTTC
CTTTTCCCACAAATTGTTAAAATTTGGGAGGTTCAGAACCCAACTTGCATTTCAAAATATATCAAGCCTATCAGTGTGTAGCCTATCATACCATAGCATA
GGACGTGTTCAACACATTCAACCATGCGTGAATACATCGGGTCAGTAAACCTCCTTCAAGCAATTCAGAAGGTAATCATTTCCATCAGGAACATACCTGA
CGTCACTATGCAACGAATATTACTTTTCTTAACCCCCATTCTACGACTTCGCAAGAAATATCAACTACCACTGCCCACAAAAAAGCTATCCATCCTCTTT
AATCTAAACAACCCTCCTGTTCGCTATCTCATCCACCTTCTTCCAAACCCAAACTTATCCTCCCATGTCATCATCCCATATACAATTCATACCAACTCAT
CCATACACTTCTCACCCCATCACTGTTTTCCCACCAACCCAACAAACTTCCTACACCCCCCCCCCATTTCTCTTCTACCCCCTCACTTAGCTTGCCAATC
ACCACTTCTCCCCTCCACTTCTCATATACTCACTTAAATCTTACCCCCTCATCTTCCTCTTCCAACTGTATTCCCTCCTATAACTCACTCACCTACCTTT
ACACCCTTATTTCACCCTCCACTCACCTTTCACCACTCTCTCCACCCCTACCTTACTTCTTCCCATCCACCCATTCTTCGATTCTAGCCTGATATACCCA
TCCATCCTTCT
>LE_HBa0163E02_SP6_262067 (trimmed for quality and cloning vector)
TGTTT

This is probably not a useful sequence.

Problems:
  • Short cloning insert
  • Low complexity
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
0.628689
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0163E02
Clone
Clone name
hba-163e2
LE_HBa0163E02
P163E02
Clone type
BAC
Contamination
none
Estimated length
172,289
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found