Clone Read LE_HBa0163E14_SP6_262078

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0163E14_SP6_262078
Primer
SP6
ID from Seq. Facility
LE_HBa_163_E14-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
546 trimmed for vector and quality, 889 raw
Sequence
>LE_HBa0163E14_SP6_262078 (raw untrimmed)
AATATTTACATTAGATACACGGAAAAATAATGAATGAACTTTTTTGGAAAAATTACAATAAAATAAAAATTTAATTTCCCTAGTACAGATAAGCGATCAA
AAAGAATTATTATTATTTTTCAATCATGGTTTCCTTTGCCTATGCCAAACTTAGATTGAGCATTAAAGTCATATAATTACAAATTAAACATTGATACATG
AGATCATCAATTCAAAAATTAAATTCTCCTACAAAATTAGATCAGGTTTTGAAAGAATGTAACTCACCGTCACATATTCACTGTCCTTCATGATAGGGGA
AAAAGGATTAAAATCGGTGTTTCTCTATCGCGCTTATCTTGTCTCTGCTAAACATGAATTAATTGAAGAAACAAAATCAGCTCAGGAAAATAAAAACAAT
TGTAACAAAATACTAGAAAATTCACAAAGAAAACTTTATGCTATAACCAAATTATTTGAACGAAAATTAGAGGAGAAAACATCAATTACTTCAAATCAAT
AAAACAACATACACACACAAAAAGGAATCTAGATAGAAAGAAAGAACTGTTTGCAAATATAAATAGATATGAAAACTCACTTCTTCTTTTTTTAAATTTG
ACATAAGGATTGTGTTACAAAGAAATTCTTCTCTATATATAATTTTTGGATTTTATCCTTTATTTATTAATAGAATCAAATTTAAGTTTTTTTCCCCTAT
ATGAATAAGTTCCAGACACTTTTTGGACATAAAAATTAATTCCCTTTTTTAATTTTTTTTAAAAAAAAGGGTTTTTCCCAAAGGAATTGTCCACTTTCTT
TTCAAAATTAAGGGTTATTTCTCCATAAAATCCCATTTTGGGAAAACAACCTTGTTATTTTCCAAAATTTGGAAAAATCTTTTGATGTG
>LE_HBa0163E14_SP6_262078 (trimmed for quality and cloning vector)
GGAAAAATAATGAATGAACTTTTTTGGAAAAATTACAATAAAATAAAAATTTAATTTCCCTAGTACAGATAAGCGATCAAAAAGAATTATTATTATTTTT
CAATCATGGTTTCCTTTGCCTATGCCAAACTTAGATTGAGCATTAAAGTCATATAATTACAAATTAAACATTGATACATGAGATCATCAATTCAAAAATT
AAATTCTCCTACAAAATTAGATCAGGTTTTGAAAGAATGTAACTCACCGTCACATATTCACTGTCCTTCATGATAGGGGAAAAAGGATTAAAATCGGTGT
TTCTCTATCGCGCTTATCTTGTCTCTGCTAAACATGAATTAATTGAAGAAACAAAATCAGCTCAGGAAAATAAAAACAATTGTAACAAAATACTAGAAAA
TTCACAAAGAAAACTTTATGCTATAACCAAATTATTTGAACGAAAATTAGAGGAGAAAACATCAATTACTTCAAATCAATAAAACAACATACACACACAA
AAAGGAATCTAGATAGAAAGAAAGAACTGTTTGCAAATATAAATAG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.893455
Expected error %
0.0735207
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0163E14
Clone
Clone name
hba-163e14
LE_HBa0163E14
C10HBa0163E14
P163E14
Clone type
BAC
Contamination
none
Estimated length
115,860
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found