Clone Read LE_HBa0163P10_SP6_262306

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0163P10_SP6_262306
Primer
SP6
ID from Seq. Facility
LE_HBa_163_P10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
468 trimmed for vector and quality, 965 raw
Sequence
>LE_HBa0163P10_SP6_262306 (raw untrimmed)
CTAGAGCTCAGATTTGTTGATACTACCCCAATCTCACCTTGACAGTGGAAGGTAAGAACTTCATTGTTTATTATGATGCATCCTATTCTGGGTTGGGTGC
AGTGCTAATGCAAGAGAAAAATGTAATTGTTTATGCTTCGAGGCAATTAAAGGTGCATAAACCTAATTATCCGACCCATGATTATGAATTGGCTGCGGTA
GTGTTTGCATTAATGTAATGGAGACACTATCTATATGGAGTTAAGTGTGAAGTATATACGGATCATCGTAGCCTACAACCTGTTTTTACTGAGAAAGAAT
TGAATTTGAGACAAAGGAGATGGATGGAACTACTGAAGGACTACGATATCACTATCTTGTATCATCCGGGAAAGGCTAATGTTCTGGCAGACGCCTTAAG
TAGAAGGGCAGGAAGCATGGAAAGTCTAGCTCACTTGCAAGTTTCTAGACGTCCATTGGCTAGAGAGGTTCAGACTCTGGCTAACGACTTTATGAGGTTA
GAGGTAAATGAGAATGGAGGATTGTTGGCTTGAATGGAAGAAAAATCTTCCCTTTTCTTGAAATTATTTATGGTAAGACTTATAATGATCAGATATTTAC
TTATCACTTTCATGTACCTTGTAAATCGAGCATGAGCAAATTATACCTCACTTCCTAATCTAAAGTACTTTATTGCTTAACCCTAAATTAACGGTTTCTG
TATACCAACCTTGTTTGTTTTTAACAAATCTCTACTTTGCACCACTACTTCTCATTACAGCTAACACTCTTACTTCTCATATATAACCTTCTAATCCAAT
TTTTTACACATTTAATTCATTTCGCGTAATCCAATCAAAGTAATTCTCACATTGCTTCCTCTCACTTAAAAACAACTATACACTCTATAATCTTACTAAT
CCGCTTTACAATCAAATAATTAATTACTCTATCTCTATACTATTTATACACCCTCCATACTCTCT
>LE_HBa0163P10_SP6_262306 (trimmed for quality and cloning vector)
CCCAATCTCACCTTGACAGTGGAAGGTAAGAACTTCATTGTTTATTATGATGCATCCTATTCTGGGTTGGGTGCAGTGCTAATGCAAGAGAAAAATGTAA
TTGTTTATGCTTCGAGGCAATTAAAGGTGCATAAACCTAATTATCCGACCCATGATTATGAATTGGCTGCGGTAGTGTTTGCATTAATGTAATGGAGACA
CTATCTATATGGAGTTAAGTGTGAAGTATATACGGATCATCGTAGCCTACAACCTGTTTTTACTGAGAAAGAATTGAATTTGAGACAAAGGAGATGGATG
GAACTACTGAAGGACTACGATATCACTATCTTGTATCATCCGGGAAAGGCTAATGTTCTGGCAGACGCCTTAAGTAGAAGGGCAGGAAGCATGGAAAGTC
TAGCTCACTTGCAAGTTTCTAGACGTCCATTGGCTAGAGAGGTTCAGACTCTGGCTAACGACTTTATG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.975715
Expected error %
0.0585699
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 224 E Value 6e-58 Identity 23.30% Align. Length 467bp (99.79%) Frame 2
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 224 E Value 8e-58 Identity 23.30% Align. Length 467bp (99.79%) Frame 2
putative polyprotein, 3'-partial [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0163P10
Clone
Clone name
hba-163p10
LE_HBa0163P10
P163P10
Clone type
BAC
Contamination
none
Estimated length
103,515
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found