Clone Read LE_HBa0165B12_SP6_262380

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0165B12_SP6_262380
Primer
SP6
ID from Seq. Facility
LE_HBa_165_B12-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
548 trimmed for vector and quality, 1011 raw
Sequence
>LE_HBa0165B12_SP6_262380 (raw untrimmed)
NNNAAGCAGTTGGCCTACAGCTTTTCATNCATTTGTGCTAACTTCTCGTCTGTTTATCTTCAGGTCACATATCACTGTTTTCACTGGAAGAAGGGAACAC
CATTTGCTGAAGACCAGGGTATCTACAACAGATTGACATGGTGGGAGCAAATGGATAATGGCAAGCAGCTTACTCCCAATAGGAAGTTTCTGACAGTTGT
TCCTGTGGTGCTGTAAGTATTCATTTCATTGTGTAAATCATTGGTTGCAGCTTTCAGCTGTGATGTCAGCAATAGTTTTGTGCTTGCGATGATAAGAATC
CACGTGTTATCATTCATGGTATAACAATCTATGCATTATAGTTCCTCATGACAATCCCAAATTATAATCTCTGTATAAGTAATCAAAGAAGTAAGCAATT
CCTTAATGTCGTGGAGTTAATAATGGGGTACTTATTTACAATCCTAGTGAACTAAGCGTATATTATTGAAAATATGTGTATGGAGGTTGTAGCAAAATGG
ACTTATGAGTGTCAACTAGAATAAAAGTTTTTCTAACACAAAATTGGTAATATGGCACCTCACAAGATTGAAGCCTGCTGTAAACCATTTTTGGTATCTA
AGTGAGAAGAGTAGAAAGACAAGACAATTATCCACCAAGTACCTTTCTAAATTCTGTTTTTTTTGGAATTAATTAAGCCTGGATCCCCTGTAAACCTTTT
TGGTACCTTCCTTGTACAATTTTAAAAAATAAAATAACTCAGTTTTTATTCATGGGAAAACCCCCTTTATTTAACCCGAGATTTTTGTATTTAGTAAACA
ATTGGGTTTTTCCATTCAATTGGGAAAAATTTTTATTAGATTCTCTTAAACTAAAAATAGAGTGGAAATTTTTTTGTACAATGTGTTTTATACCTTGATA
TACAAGAACAGGGAGCTGACCTCTTTTTTATTCTTTATTAAAGTGATCTTCTCTCACCTCCTCAAAGTCTCAAAAACAAATTTTTAGGGGATTCTTTATA
GATGCCCTATA
>LE_HBa0165B12_SP6_262380 (trimmed for quality and cloning vector)
TAACTTCTCGTCTGTTTATCTTCAGGTCACATATCACTGTTTTCACTGGAAGAAGGGAACACCATTTGCTGAAGACCAGGGTATCTACAACAGATTGACA
TGGTGGGAGCAAATGGATAATGGCAAGCAGCTTACTCCCAATAGGAAGTTTCTGACAGTTGTTCCTGTGGTGCTGTAAGTATTCATTTCATTGTGTAAAT
CATTGGTTGCAGCTTTCAGCTGTGATGTCAGCAATAGTTTTGTGCTTGCGATGATAAGAATCCACGTGTTATCATTCATGGTATAACAATCTATGCATTA
TAGTTCCTCATGACAATCCCAAATTATAATCTCTGTATAAGTAATCAAAGAAGTAAGCAATTCCTTAATGTCGTGGAGTTAATAATGGGGTACTTATTTA
CAATCCTAGTGAACTAAGCGTATATTATTGAAAATATGTGTATGGAGGTTGTAGCAAAATGGACTTATGAGTGTCAACTAGAATAAAAGTTTTTCTAACA
CAAAATTGGTAATATGGCACCTCACAAGATTGAAGCCTGCTGTAAACC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.960724
Expected error %
0.0860475
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g42000.1 Score 94 E Value 6e-20 Identity 27.00% Align. Length 140bp (25.55%) Frame 3
68418.m05113 ORMDL family protein contains Pfam domain PF04061: ORMDL family
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g01230.1 Score 90 E Value 7e-19 Identity 28.80% Align. Length 131bp (23.91%) Frame 3
68414.m00038 ORMDL family protein contains Pfam domain PF04061: ORMDL family
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAD41291.2| Score 94 E Value 1e-18 Identity 27.70% Align. Length 140bp (25.55%) Frame 3
OSJNBa0005N02.9 [Oryza sativa (japonica cultivar-group)] ref|XP_473535.1| OSJNBa0005N02.9 [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD94546.1| Score 94 E Value 3e-18 Identity 27.00% Align. Length 140bp (25.55%) Frame 3
putative protein [Arabidopsis thaliana] dbj|BAB08433.1| unnamed protein product [Arabidopsis thaliana] ref|NP_199015.1| ORMDL family protein [Arabidopsis thaliana] gb|AAS47671.1| At5g42000 [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0165B12
Clone
Clone name
hba-165b12
LE_HBa0165B12
C12HBa0165B12
P165B12
Clone type
BAC
Contamination
none
Estimated length
79,320
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found