Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Clone Read LE_HBa0165C11_SP6_262420

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0165C11_SP6_262420
Primer
SP6
ID from Seq. Facility
LE_HBa_165_C11-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
605 trimmed for vector and quality, 980 raw
Sequence
>LE_HBa0165C11_SP6_262420 (raw untrimmed)
NNNNAGCTATTGNACCATGGCTGAGAGGTCAACTCTAGCTATGACTTGATGAAATTAGAAGTAAATGAGAGGGGAGGATTGTTGGCTTCTGTGGAGGCAA
GATCTTCCTTTCTTGACAAGATTAAGGAAAGACAGTCTGATGATGAGAAACTGCGCAGAATTCAAGATAAAGTATTGCGAGGAGAGGCTAAGGAAGCACA
AATCGATGAGGAAGGTGTTTTGAGAATCAAGGGAAGGGTATGTGTACCCCGCGTCGATGATTTGATCAACACTATTCTGACAGAGGCTCATAGTTCAAGG
TATTCTATACATCCGGGTGCAACCAAGATGTATCGTGACCTAAAGCAACACTTTTGGTGGAGTAGAATGAAGCGTGATATTGTTGACTTTATTGCCAAGT
GTCCGAACTGTCAACAAGTAAAGTGTGAACACCAAAGGCTCGGAGGAACACTTCAGAGAATGCCCATTTCGGAATGGAAGTGGGAAAGAATTGCAATGGA
TTTTGTGGTTGGTCTTCCGAAGACAATGGGTAAGTATGACTCCATTTGGGTGATTGTTGATAGGTTAACTAAATTTGCTCATTTCATTCCGGTCAAGGTG
ACTTACAATGCAGAAAAGTTAGCCAAACTTTACATCTCGGAAGTGGTGCGATTGCATGGGGTTCCACTATCCATCATATCAGATAGAGGTACCCAGTTTA
CTTCTAAATTTTGGAAAAACATTGCATCCAAAATTGGAATCTAGGGTTGGACCTTAATAATGCCGTTCCATCCCCAGACCGAATGGGACATGCGCGAACC
AAATAATTTCTAGGGTTGGAAGCGAATTCCTCCTCGGCCTGTGTGTATATAAATTTGGAGGGCCCTTGTGGATTCCTTCTCTTCACCCCTAACTGTAATT
TCTTCTAGAGAATATTTACTTATCTTCTCCTAACAGATTTTATATTAGACTCCCTTTATTCAATACTTTTTATGGAATAA
>LE_HBa0165C11_SP6_262420 (trimmed for quality and cloning vector)
CAACTCTAGCTATGACTTGATGAAATTAGAAGTAAATGAGAGGGGAGGATTGTTGGCTTCTGTGGAGGCAAGATCTTCCTTTCTTGACAAGATTAAGGAA
AGACAGTCTGATGATGAGAAACTGCGCAGAATTCAAGATAAAGTATTGCGAGGAGAGGCTAAGGAAGCACAAATCGATGAGGAAGGTGTTTTGAGAATCA
AGGGAAGGGTATGTGTACCCCGCGTCGATGATTTGATCAACACTATTCTGACAGAGGCTCATAGTTCAAGGTATTCTATACATCCGGGTGCAACCAAGAT
GTATCGTGACCTAAAGCAACACTTTTGGTGGAGTAGAATGAAGCGTGATATTGTTGACTTTATTGCCAAGTGTCCGAACTGTCAACAAGTAAAGTGTGAA
CACCAAAGGCTCGGAGGAACACTTCAGAGAATGCCCATTTCGGAATGGAAGTGGGAAAGAATTGCAATGGATTTTGTGGTTGGTCTTCCGAAGACAATGG
GTAAGTATGACTCCATTTGGGTGATTGTTGATAGGTTAACTAAATTTGCTCATTTCATTCCGGTCAAGGTGACTTACAATGCAGAAAAGTTAGCCAAACT
TTACA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.970039
Expected error %
0.178128
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 248 E Value 6e-65 Identity 19.20% Align. Length 587bp (97.02%) Frame 3
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 248 E Value 1e-64 Identity 19.00% Align. Length 587bp (97.02%) Frame 3
putative polyprotein, 3'-partial [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0165C11
Clone
Clone name
hba-165c11
LE_HBa0165C11
P165C11
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found