Clone Read LE_HBa0165K18_SP6_262769

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0165K18_SP6_262769
Primer
SP6
ID from Seq. Facility
LE_HBa_165_K18-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
591 trimmed for vector and quality, 975 raw
Sequence
>LE_HBa0165K18_SP6_262769 (raw untrimmed)
GCACTGATNAGGAGTCTGATCTGGGAGAACACCTTCATAGTGCAGTCCACACACAACCCAGCCACAGATGAGATTCGTGAAGAAATGGCTCAGATGAGAA
CTGATCTTGGGTTGGTACTAAAATATGTCACTGGGGGTGCAGAAAAGATAAATGCAGTCAACTACTTGTCGAAACCACCGCCACAAAATGATGAGTGTTA
TTATAAGGAGGATTCCTATGCGGTAAATGCGCAGACGGGGGGTTTCCGACAAAGTGCCCAAGGCTCTAATCAGGAGAATTGGCGCCAAGGTAAAGGGAAC
CAAGGTCGGAACTATGGTAACTACAATCATGAGGGTCATTATGTCTGAGATGGAAACTATAACCGCAACACCAACTTCAACAGGGGTAACTATGGTAATA
GAAATGACAGGAATGGGCCCTATGTTCCTTCTCAAAATCGTGAAGTTACTCTTAGGGATGGTGGAGGTAGTATGGCGCGAGTTGAGGATATGTTGCACAA
AATCATGAGGAGGTTTGATGCTAGTGATGAGCACAATAAAGAGTTGAGGAATGATTTAGTGGGTATTGGGAAAAGAGTCGATACACATGTAATATCGATT
AAGAAACTTGAGTTACATTTGGCCCAATTATCTTACGACTGTGAACACACGGCAACCGGGCACTCTTCCTAGCACCTTTGTCCAAATCCGAAAAAATGAT
GGACATTGGTATGGCAATTACTACTCCGGTGGGAAAGCAAACCATTGACCCCCCTATGCCCGTCCAAAGAGAAAATGGGTGACAAAAGAATACCGATAAA
TTGGAAAATGTTGATGGTGAAATTAAGGAAATACATTTAAAAAAATTTTAAATTTTCCTAAAAAGGGTAACCGCCCCCTTCTCATAGCTCCCCTCCCCCT
TTTTTTTTTAAAATTTTTTTGAAAATACCAACGATGGGTAATATTTGGGGGATTTTAATAAAAAAGTTATAAAAG
>LE_HBa0165K18_SP6_262769 (trimmed for quality and cloning vector)
CTGGGAGAACACCTTCATAGTGCAGTCCACACACAACCCAGCCACAGATGAGATTCGTGAAGAAATGGCTCAGATGAGAACTGATCTTGGGTTGGTACTA
AAATATGTCACTGGGGGTGCAGAAAAGATAAATGCAGTCAACTACTTGTCGAAACCACCGCCACAAAATGATGAGTGTTATTATAAGGAGGATTCCTATG
CGGTAAATGCGCAGACGGGGGGTTTCCGACAAAGTGCCCAAGGCTCTAATCAGGAGAATTGGCGCCAAGGTAAAGGGAACCAAGGTCGGAACTATGGTAA
CTACAATCATGAGGGTCATTATGTCTGAGATGGAAACTATAACCGCAACACCAACTTCAACAGGGGTAACTATGGTAATAGAAATGACAGGAATGGGCCC
TATGTTCCTTCTCAAAATCGTGAAGTTACTCTTAGGGATGGTGGAGGTAGTATGGCGCGAGTTGAGGATATGTTGCACAAAATCATGAGGAGGTTTGATG
CTAGTGATGAGCACAATAAAGAGTTGAGGAATGATTTAGTGGGTATTGGGAAAAGAGTCGATACACATGTAATATCGATTAAGAAACTTGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.97028
Expected error %
0.121352
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38730.1| Score 171 E Value 9e-42 Identity 15.70% Align. Length 554bp (93.74%) Frame 3
putative reverse transcriptase [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0165K18
Clone
Clone name
hba-165k18
LE_HBa0165K18
P165K18
Clone type
BAC
Contamination
none
Estimated length
81,193
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found