Clone Read LE_HBa0168A23_SP6_262929

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0168A23_SP6_262929
Primer
SP6
ID from Seq. Facility
LE_HBa_168_A23-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
524 trimmed for vector and quality, 852 raw
Genbank Accession
Sequence
>LE_HBa0168A23_SP6_262929 (raw untrimmed)
TAGCTGCTGGATCAGTTCAACTGGGAATCTATGTTGCAACTCTTTCAGTGAGGTTGCAATTTTACTACGGGCATCGGATTCTCTAGTCCATGATCTGTGC
CATGTGTATGATTCCTGCAGTGATAAGACTGTCTCAAGGCCCCCAAAGTTTTTTCTTGCACTTCGCAAATGGTACTCATCCCTGCGGCCCGAGATGGAAT
TTCGCTGCTTTGTACGCAATGGGATCCTTGTGGGGGTCTCTCAGCGCGAGGTGACTGGATTTTATCCTGCTCTTGTTGAGAAGAAAGATGAGCTGATAAC
AATAGTCCAGAGATTTTTTATGTATAAGGTGAAGGGAAATTTTGAATCAGAAAGTTATACTTTTGATATATATGTCACAAATGATGACCGAGTTAAGCTT
TTGGATTTTAATCCTTGGGGCGCATTTACCTTACCTTTGCTTTTCACCTGGGAGGAATTAGAAGTTAATTCGAATAAAGAGGGAGATCACTTGGAGTTTA
GACTTGTAGAAAGCCAGTGTGGGGTTCGTCCTGGTTTGAAAACTGCTGTTCCTTATGATTACCTGGATACTAGTCCAGGTAGTGTTTGGGATGAGTTTCT
TTCATACGTTGATCAAGAATTTGTGATAACAGATCATGATCTACATCTAACTAGTAGCTTGATTACTTATATTTTTCACACTACTGAAAGTGCTCTTCTT
ACTCTACTCAAATCACTAAGAATCCTTAAGCACTAGTTAATTTAATATATATATACGTCAAATATCATTAATACCTTATTTTATTCATACATGAAAAAAT
TTTCTTCAACATTTTTTTTTTTTCTCAGAACTTATTTCCCTCCATATTCTTA
>LE_HBa0168A23_SP6_262929 (trimmed for quality and cloning vector)
TGGATCAGTTCAACTGGGAATCTATGTTGCAACTCTTTCAGTGAGGTTGCAATTTTACTACGGGCATCGGATTCTCTAGTCCATGATCTGTGCCATGTGT
ATGATTCCTGCAGTGATAAGACTGTCTCAAGGCCCCCAAAGTTTTTTCTTGCACTTCGCAAATGGTACTCATCCCTGCGGCCCGAGATGGAATTTCGCTG
CTTTGTACGCAATGGGATCCTTGTGGGGGTCTCTCAGCGCGAGGTGACTGGATTTTATCCTGCTCTTGTTGAGAAGAAAGATGAGCTGATAACAATAGTC
CAGAGATTTTTTATGTATAAGGTGAAGGGAAATTTTGAATCAGAAAGTTATACTTTTGATATATATGTCACAAATGATGACCGAGTTAAGCTTTTGGATT
TTAATCCTTGGGGCGCATTTACCTTACCTTTGCTTTTCACCTGGGAGGAATTAGAAGTTAATTCGAATAAAGAGGGAGATCACTTGGAGTTTAGACTTGT
AGAAAGCCAGTGTGGGGTTCGTCC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.9678
Expected error %
0.220759
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g05440.1 Score 215 E Value 1e-56 Identity 19.80% Align. Length 518bp (98.85%) Frame 2
68417.m00826 temperature sensing protein-related contains weak similarity to D123 (GI:1236114) [Rattus norvegicus]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB81086.1| Score 215 E Value 4e-55 Identity 19.80% Align. Length 518bp (98.85%) Frame 2
D123-like protein [Arabidopsis thaliana] ref|NP_192453.1| temperature sensing protein-related [Arabidopsis thaliana] pir||D85068 D123-like protein [imported] - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_446329.1| Score 128 E Value 8e-29 Identity 12.90% Align. Length 503bp (95.99%) Frame 2
D123 gene product [Rattus norvegicus] gb|AAH61527.1| D123 gene product [Rattus norvegicus] gb|AAB60521.1| D123
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0168A23
Clone
Clone name
hba-168a23
LE_HBa0168A23
P168A23
Clone type
BAC
Contamination
none
Estimated length
114,465
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found