Clone Read LE_HBa0168G04_SP6_263032

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0168G04_SP6_263032
Primer
SP6
ID from Seq. Facility
LE_HBa_168_G04-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
640 trimmed for vector and quality, 865 raw
Genbank Accession
Sequence
>LE_HBa0168G04_SP6_263032 (raw untrimmed)
TCGGTTCAAGAGAAGGAGGAGTATCTTCTTATGCAATAATGCTTCTACTGGCAATGAGTCTGGAATGATTGACTCAACTTCAGGTTCTAATGCTAGAACA
AATAAGTCATCTAATGATACTACTTTAGGACAGGGTGTATCAATGTTTACTCAAGAACAATATTATGAGATCTTGCAGATGCTGAGAAAAGGAAAGAGTA
AGGAAGTGGATACAATGGCCAATGTAGCTACTGCAGGTGTATCTGGAACATCAGGTGCCTCCAATCATATGGTTCACAACTTTGGTTTAATGAGTCAGTC
AACAAATCTTGATGTTCAGGGTGGTATGAGAGTTAATTTACCTACTGGTGATCAGGTGTCTATTAGTCATATTGGTGAATCTTTGATTCTTAAAGATAAA
GTAGTAAAGGATGTGTTGTTTGTTCCAGAATTCAAGTATAATCTTCTATCAGTGTCACAACTAACAAAATAGTTGAAGTGTGCAGTAGTATTTTTTCCTG
ATTTTTGTATTTTTCAGGATCTCTTCAATGGGAGGGTACTGGGGATTGGTAAGAGAATCAAGGATTGTATATCCTCAATAATGCTGTCACAACAAAGCCT
TTCAATGATCAAGTATCTTCTGAACAATGTGCAAAGGAAGCTGCATATAAAAGAATTAGGCCTATTATTTTTAATTCTACTGCTGATTCTTTAAGTAGTC
TATGGCATAAAAGACTTGGACATGCTCCTCTCAAAGTGTTAAGTAAAATAAGGAATTTGAACATTGTATCTGCACCTGAGTAACATTGGTTCCAATAGTC
CCATTTGCTAACCAATTCAAAACGTCCTTTTTCCCTATAATTCTTTCCTCAATCAAATTCAAATG
>LE_HBa0168G04_SP6_263032 (trimmed for quality and cloning vector)
AGAGAAGGAGGAGTATCTTCTTATGCAATAATGCTTCTACTGGCAATGAGTCTGGAATGATTGACTCAACTTCAGGTTCTAATGCTAGAACAAATAAGTC
ATCTAATGATACTACTTTAGGACAGGGTGTATCAATGTTTACTCAAGAACAATATTATGAGATCTTGCAGATGCTGAGAAAAGGAAAGAGTAAGGAAGTG
GATACAATGGCCAATGTAGCTACTGCAGGTGTATCTGGAACATCAGGTGCCTCCAATCATATGGTTCACAACTTTGGTTTAATGAGTCAGTCAACAAATC
TTGATGTTCAGGGTGGTATGAGAGTTAATTTACCTACTGGTGATCAGGTGTCTATTAGTCATATTGGTGAATCTTTGATTCTTAAAGATAAAGTAGTAAA
GGATGTGTTGTTTGTTCCAGAATTCAAGTATAATCTTCTATCAGTGTCACAACTAACAAAATAGTTGAAGTGTGCAGTAGTATTTTTTCCTGATTTTTGT
ATTTTTCAGGATCTCTTCAATGGGAGGGTACTGGGGATTGGTAAGAGAATCAAGGATTGTATATCCTCAATAATGCTGTCACAACAAAGCCTTTCAATGA
TCAAGTATCTTCTGAACAATGTGCAAAGGAAGCTGCATAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.945995
Expected error %
0.118062
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89728.1| Score 105 E Value 1e-21 Identity 14.60% Align. Length 512bp (80.00%) Frame 1
putative retroelement pol polyprotein-like [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD25646.1| Score 74 E Value 3e-12 Identity 14.60% Align. Length 308bp (48.12%) Frame 1
putative retroelement pol polyprotein [Arabidopsis thaliana] pir||E84589 probable retroelement pol polyprotein [imported] - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0168G04
Clone
Clone name
hba-168g4
LE_HBa0168G04
C01HBa0168G04
P168G04
Clone type
BAC
Contamination
none
Estimated length
127,804
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found