Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Clone Read LE_HBa0171B21_SP6_263274

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0171B21_SP6_263274
Primer
SP6
ID from Seq. Facility
LE_HBa_171_B21-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
3 trimmed for vector and quality, 1279 raw
Sequence
>LE_HBa0171B21_SP6_263274 (raw untrimmed)
GGGTCCTCAGGGAGACTACTATTCCCTGAGTCTTAGATGCTCAAGTCTGTTTTCGCAGATCACTTCTGATTGTAGCGATGATACTGGTATATCTTCCTTG
CTTGCGTGAGAGGTAGTCTACACCATAGATAGATGTCTCACGACAGATGATGTTTGGTGGTATCACTGCCTACTACGTTCACACTTTATATATATGGTCT
TACGTACGTAGATGTTGTGATGATCTATACCTCACAGTGTCTTTCCATGTACAATGGCTACATCCTAGCTCACTCATGTGCGTTCTCCCTCATCTATTCT
ACCTGTGTGTCACATAGATT
TCTATACTGAGTCTAATTCCACCGTATACGCATGACTTATTCGGTCAGTCTCTTATGTAGCAGGTTCTCCTAATAGATTT
AAGACTCTCCTCAACGCTTTCTGCGGTTGTGTACAAGACTGCAGCTATCGCCTCATTGTAGCTCTTTCTGACCTCATGTTGCGTCATGGATCAATGATNT
GCAGAGCTATCTGCCGATATTGTGCTGTGATTCCTATACTTTTCTTGCTACCGCTCTCTTTCTCGCCTCGATTTTATCTCTTGCATCAGTATTGTATCTA
CTATATTCTCTTCGTATTCTCATTAACTTCACTCTCATGAGCAATTTATGCTCCTACATTCACTCTATACCTATCAATCTTATAATCATAATCAATTTAT
CTTCACTTTTATCATACCTACATATTACTGCTCTATATTACTTACTATTCTTACTTCTGCCTATCATCTCTAATATATGCACGCCTCATTGTCTGCACTC
CTTCTCCTCCACATTAACGCTCTAGTCTTTCCCTCCTGCTTTACATAACTTCTATAACAGACCTTATTCATCTATACACTGCTCCTTTATATCTATACTT
TCATCTATATCTATATACTCATCACTTTTATTGCATTCTACTGTTTTCCCATCTTTATGCTTCCTGATACCTCTATTCCTCTTCTTCTCAATCTGCTTCT
TCTACTTTCATCCCTTCCTCCTTTTATATCTTTCTATCTTCTCTTCACAGTCTTATCATTGTGTTCACTTTGTGCCATTCATCTCTCACCCTACTTCCCT
CTAGCATACTCACTACTACTACCTTAATGATTCATGAGCACCTTGACTTTTCTTACTTCTCACCACATCTACTCATACTCAATACTTCTATTATCATACA
CTTCATTCTTCTATCTATGCATCTCTATCATATCAGACTTACTGTATCCATCATTTATCTATATATCGACTATGCATCG
>LE_HBa0171B21_SP6_263274 (trimmed for quality and cloning vector)
TCT

This is probably not a useful sequence.

Problems:
  • Low complexity
  • Short cloning insert
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
0.84028
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0171B21
Clone
Clone name
hba-171b21
LE_HBa0171B21
C04HBa0171B21
P171B21
Clone type
BAC
Contamination
none
Estimated length
101,281
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found