Clone Read LE_HBa0175G03_SP6_263701

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0175G03_SP6_263701
Primer
SP6
ID from Seq. Facility
LE_HBa_175_G03-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
676 trimmed for vector and quality, 987 raw
Genbank Accession
Sequence
>LE_HBa0175G03_SP6_263701 (raw untrimmed)
TCTTANNNCCGCATGACCCATTGTCTGAGAGGTTCAACTCTAGCTAATGACTTGATGAGATTAGAAGTAAATGAGAATGGAGGATTGTTGGCTTCTGTGG
AGGCAAGATCTGTCTTCCTTGACAAGATTAAGGGAAGACAGTCTGATGATGAGAAACTGCGCAGAATTTAAGATAAGGTATTGCGAGGAGAGGCTAAGGA
AGCACAAATTGACAAGGAAGGTGTTTTGAGGATCAAGGGAAGGGTATGTGTACCCCGCATCGATGGTTTGATCAACACTATTCTGACAGAGGCTCATAGT
TCAAAGTATTCTTTACATCCGGGCGCAACCAAGATGTATCGTGACCTAAAGCAACACTTTTGGTGGAGTAGAATGAAGCGTGATATTGTTGATTTTATTG
CCAGATGTCCAAACTGTCAACAAGTAAAGTATGAACACCAGAGGCCCGGAGGAACACTTCAGAGAATGCCCATTCCGGAATGGAAGTGGGAAAGAATTGC
AATGGACTTTGTGGTTGGTCTTCCCAAGACATTGGGAAAGTTTGATTCTATTTGGGTAATTGTTGATAGGTTAACTAAGTCTGCTCACTTCATTCCTGTC
AAGGTGACTTACAATGCAGAGAAGTTAGCCAAACTTTACATCTCGGAAGTGGTGCGATTGCATGGGGTTCTACTATCCATCATATCAGATAGAGGTACGC
AGTTTACTTCTAAGTTTTGAAAACATTGCATGCGGAATAAGGTACTAGGTTGGACCTTAGTACTGCGTTCCTCCCTCCGACCGATGGTCAGTCCTAAAGA
ACGATTCAGGTGTTGGAAGATATGCTTCCTGCCTGGTGTGATAATGTTGGGTGGCCCTTGGGGAAACCTTCTTACCCTTTAGCGAAGTTTTTCTTCAATA
AAGCCTATTACCTAAGCCTTGGTATGGCCTCCTTTTGAACCCTTTTTTTGGTAGGGAAAATAAGGGCTCCCCCCTTGATGGGTTTGA
>LE_HBa0175G03_SP6_263701 (trimmed for quality and cloning vector)
AACTCTAGCTAATGACTTGATGAGATTAGAAGTAAATGAGAATGGAGGATTGTTGGCTTCTGTGGAGGCAAGATCTGTCTTCCTTGACAAGATTAAGGGA
AGACAGTCTGATGATGAGAAACTGCGCAGAATTTAAGATAAGGTATTGCGAGGAGAGGCTAAGGAAGCACAAATTGACAAGGAAGGTGTTTTGAGGATCA
AGGGAAGGGTATGTGTACCCCGCATCGATGGTTTGATCAACACTATTCTGACAGAGGCTCATAGTTCAAAGTATTCTTTACATCCGGGCGCAACCAAGAT
GTATCGTGACCTAAAGCAACACTTTTGGTGGAGTAGAATGAAGCGTGATATTGTTGATTTTATTGCCAGATGTCCAAACTGTCAACAAGTAAAGTATGAA
CACCAGAGGCCCGGAGGAACACTTCAGAGAATGCCCATTCCGGAATGGAAGTGGGAAAGAATTGCAATGGACTTTGTGGTTGGTCTTCCCAAGACATTGG
GAAAGTTTGATTCTATTTGGGTAATTGTTGATAGGTTAACTAAGTCTGCTCACTTCATTCCTGTCAAGGTGACTTACAATGCAGAGAAGTTAGCCAAACT
TTACATCTCGGAAGTGGTGCGATTGCATGGGGTTCTACTATCCATCATATCAGATAGAGGTACGCAGTTTACTTCT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.971569
Expected error %
0.0806684
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 296 E Value 4e-79 Identity 20.30% Align. Length 674bp (99.70%) Frame 3
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 295 E Value 9e-79 Identity 20.20% Align. Length 671bp (99.26%) Frame 3
putative polyprotein, 3'-partial [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0175G03
Clone
Clone name
hba-175g3
LE_HBa0175G03
C02HBa0175G03
P175G03
Clone type
BAC
Contamination
none
Estimated length
52,592
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found