Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0175H08_SP6_263726

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0175H08_SP6_263726
Primer
SP6
ID from Seq. Facility
LE_HBa_175_H08-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
532 trimmed for vector and quality, 985 raw
Genbank Accession
Sequence
>LE_HBa0175H08_SP6_263726 (raw untrimmed)
CCGCTAGATTAAATTTTTCATAGCTTTGATTTATAGATATAAATCAAAATATAAATTATAAAATATATTTATATATATCTTAAATGTAGATAATGATTCT
AGAGAGACTATCCTTTAGATCTTATCTAAGTTGTGATATAAAAATCTTTTTCTTTTATCTATATGAGTTGTGACATGATGGATTTTACTATATTTCGTTA
ACGTTTATATAATTTTTGTGAATTTTGGATATGTTTGAATTCGATCTCTCATTAGGTTTTTAGGAATGTTTCGTATTTTAGTTAAGTCGGGTCAAGGCCC
ACGAGGCCCAAATTGAACTGACCCGGGTCCATCACTATGTCAAAGAAATTCCAATTGGAAATTTTCTTTCTTCTTCACTCTCTCTGTATTATTTCACTCT
CCTCCAGCGTATAAAGCAAGCTGAATTTTTTCTCATACATACAACAATGGCGGAACCTAAAGTCAAATATGATCGTCAGCTCAGGTGAATTTTTTAGTGT
ATTCTATGTTTTCTGCTTTCGGTTCTGTTATGAACGCCATCACTGAATGTGTAGTTCTTAGATAGTTGGATTGAATTGAAAATTTTAGTAGAGGAAATGA
GAAAAAAAGCATCGTTTTTATGGGATATGCTACGGTTGTGGGGAAATTTATTTGAAGAAACGTCTATTGTGTGCTAGGAATTTCTAAACTAGATAAATGT
GGCTTAAATCTGGGGTTTTATATACGTCCTATATTGTCAATAACTCAGTTTTCTCCTAAACGGTTATGATGCTTTTTACTTGTTTGCTAATGTAAAAACT
TATGCACTCATCTATGATATGATAACACCTCATTTAATTAAAAAATTTAGTTCATGTTTCAAAACTTTAATTTAGAATGTGTCTTATTCTTACACTACTT
TTACTACTCGCTTCAGGCCACTTTTTATGAACTATTCTATCATAACACATTTATATTTTATATCCTAATTCTTTTTACAAATATA
>LE_HBa0175H08_SP6_263726 (trimmed for quality and cloning vector)
GCTTTGATTTATAGATATAAATCAAAATATAAATTATAAAATATATTTATATATATCTTAAATGTAGATAATGATTCTAGAGAGACTATCCTTTAGATCT
TATCTAAGTTGTGATATAAAAATCTTTTTCTTTTATCTATATGAGTTGTGACATGATGGATTTTACTATATTTCGTTAACGTTTATATAATTTTTGTGAA
TTTTGGATATGTTTGAATTCGATCTCTCATTAGGTTTTTAGGAATGTTTCGTATTTTAGTTAAGTCGGGTCAAGGCCCACGAGGCCCAAATTGAACTGAC
CCGGGTCCATCACTATGTCAAAGAAATTCCAATTGGAAATTTTCTTTCTTCTTCACTCTCTCTGTATTATTTCACTCTCCTCCAGCGTATAAAGCAAGCT
GAATTTTTTCTCATACATACAACAATGGCGGAACCTAAAGTCAAATATGATCGTCAGCTCAGGTGAATTTTTTAGTGTATTCTATGTTTTCTGCTTTCGG
TTCTGTTATGAACGCCATCACTGAATGTGTAG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.927713
Expected error %
0.179601
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0175H08
Clone
Clone name
hba-175h8
LE_HBa0175H08
P175H08
Clone type
BAC
Contamination
none
Estimated length
78,043
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found