Clone Read LE_HBa0175J15_SP6_263774

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0175J15_SP6_263774
Primer
SP6
ID from Seq. Facility
LE_HBa_175_J15-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
489 trimmed for vector and quality, 997 raw
Genbank Accession
Sequence
>LE_HBa0175J15_SP6_263774 (raw untrimmed)
ATATCAGCTTGTGACGGTCTGTCGTGTCTATGGCGGTCCATCCTGCAGGTTCGTCATGAAGTTCAGAGAAGTAATCCAGTACCAATATTCCAAGAGTTGA
AGTGTTTTGGAACGAAGGCCCTCGACGGACCGTTGTGCCTATGACTGTCCGTCATACTTGCCGTCGAGGGTAATGAAGAAGAGCAGCTGAAGAAATTGCA
TAAGTATGGGACGACGGAGTCCATGACGGTCCGTCGTGACCATGACGATCCGTCGCGAGGTCCGTCGACCCAGCCGCGTTTTGGAAGATTTCCAGCAAAT
AGAGTCCTTGTTTAATTAGGTTTTTATTTTTTATAAATAGTTCGAAAAACCTCGTTTTTGAGGTTAGACTCTGGTAGGTTTGACAACATATTATTGTGAG
CCCTTTGTACAAGTGTTAGATTATTGATTACTTTGAGATTCTTGAATGTGACTTTTGGTGATTAATCAAGCAAACTTTTGGATTTTACTCTTTCTCATTG
AAGTGAGTACATGAATTCTTATTTAATATATTTGAATATTGTGATTATGACTAATGGGGAACTAAACCCCATATTTAGGGTTCTTGGTAACTTAGGTGAA
TTATGGAATTATATTAACCAAAATAACTATTCTAGATTATTGTGTTGCATGTTTTTAATATATTTTTCCTTCTACATCTTTTTTCCTTAACTGTTACCTT
TAGAATCACTTCTTATTCTTATCATCGGAATCTGTTATCTTTTTACTATATTATATTTTTTAACTTTTATATTATTCTTCTTTTATCTACTGCTATTTAT
TTTTTTTTTTAATTCTCATTTTCCTTTATTATTCTTCTTACTTCTTCTTTTCTTTAGATTTTCTTTTCCTTTTTTTTTTATTTTTTATTCTGCGATTTTC
GTCTACTTCTATATTTCATTATTCGTTATATATTGTATAGTTTGTTATCTTTATACTATTTCCTTTATCTTTTCCTCTTTCTTCTTTATATACTTAC
>LE_HBa0175J15_SP6_263774 (trimmed for quality and cloning vector)
TCAGCTTGTGACGGTCTGTCGTGTCTATGGCGGTCCATCCTGCAGGTTCGTCATGAAGTTCAGAGAAGTAATCCAGTACCAATATTCCAAGAGTTGAAGT
GTTTTGGAACGAAGGCCCTCGACGGACCGTTGTGCCTATGACTGTCCGTCATACTTGCCGTCGAGGGTAATGAAGAAGAGCAGCTGAAGAAATTGCATAA
GTATGGGACGACGGAGTCCATGACGGTCCGTCGTGACCATGACGATCCGTCGCGAGGTCCGTCGACCCAGCCGCGTTTTGGAAGATTTCCAGCAAATAGA
GTCCTTGTTTAATTAGGTTTTTATTTTTTATAAATAGTTCGAAAAACCTCGTTTTTGAGGTTAGACTCTGGTAGGTTTGACAACATATTATTGTGAGCCC
TTTGTACAAGTGTTAGATTATTGATTACTTTGAGATTCTTGAATGTGACTTTTGGTGATTAATCAAGCAAACTTTTGGATTTTACTCTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.963248
Expected error %
0.210949
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0175J15
Clone
Clone name
hba-175j15
LE_HBa0175J15
C08HBa0175J15
P175J15
Clone type
BAC
Contamination
none
Estimated length
139,400
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found